Incidental Mutation 'R1554:Ogn'
ID170184
Institutional Source Beutler Lab
Gene Symbol Ogn
Ensembl Gene ENSMUSG00000021390
Gene Nameosteoglycin
Synonymsmimecan, SLRR3A, OG, 3110079A16Rik, mimican
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49608046-49624501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49621044 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 221 (D221A)
Ref Sequence ENSEMBL: ENSMUSP00000021822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021822]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021822
AA Change: D221A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021822
Gene: ENSMUSG00000021390
AA Change: D221A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 93 123 3.52e0 SMART
LRR_TYP 142 165 4.4e-2 SMART
LRR 166 187 1.33e2 SMART
LRR 212 235 3.78e-1 SMART
LRR 236 256 5.27e1 SMART
low complexity region 263 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene display reduced collagen fiber density and organization, as well as more variability in fibrilar diameter in both the skin and the cornea. Corneal clarity was unaffected whereas skin tensile strength was reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Ogn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ogn APN 13 49621038 missense probably damaging 1.00
IGL00475:Ogn APN 13 49622915 missense probably benign 0.01
IGL01830:Ogn APN 13 49609247 nonsense probably null
R0116:Ogn UTSW 13 49621038 missense possibly damaging 0.89
R1546:Ogn UTSW 13 49609333 missense probably benign 0.00
R3752:Ogn UTSW 13 49622831 missense probably benign 0.44
R4005:Ogn UTSW 13 49609299 missense possibly damaging 0.82
R5323:Ogn UTSW 13 49609341 missense probably benign 0.00
R5946:Ogn UTSW 13 49618285 missense probably benign 0.01
R7854:Ogn UTSW 13 49621038 missense possibly damaging 0.89
R7970:Ogn UTSW 13 49609266 missense probably benign
R8426:Ogn UTSW 13 49621091 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGCTCCCTAGACAAACTTCAAAGGC -3'
(R):5'- AGCATACTCTGGACTGGACCTACAG -3'

Sequencing Primer
(F):5'- CGTGGAGTATGCAATAGCATTC -3'
(R):5'- CATACTGCTTTAGCCATGTAACTG -3'
Posted On2014-04-13