Incidental Mutation 'R1554:Ercc4'
ID 170188
Institutional Source Beutler Lab
Gene Symbol Ercc4
Ensembl Gene ENSMUSG00000022545
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 4
Synonyms Xpf
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R1554 (G1)
Quality Score 197
Status Not validated
Chromosome 16
Chromosomal Location 12927548-12968481 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12965486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 706 (D706G)
Ref Sequence ENSEMBL: ENSMUSP00000023206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023206] [ENSMUST00000129049]
AlphaFold Q9QZD4
Predicted Effect probably damaging
Transcript: ENSMUST00000023206
AA Change: D706G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023206
Gene: ENSMUSG00000022545
AA Change: D706G

DomainStartEndE-ValueType
Blast:DEXDc 8 187 1e-5 BLAST
ERCC4 684 764 1.11e-26 SMART
low complexity region 789 802 N/A INTRINSIC
PDB:2AQ0|B 835 917 6e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156393
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice show impaired growth and do not survive longer than several weeks of age. Cultutred cells obtained from mutant mice were shown to be hypersensitive to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Btaf1 A G 19: 36,973,998 (GRCm39) D1390G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Dtx1 T C 5: 120,821,386 (GRCm39) K387R probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Pfkfb2 A G 1: 130,634,209 (GRCm39) V156A probably damaging Het
Ppp4r3a A T 12: 101,022,081 (GRCm39) D307E probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc16a7 A C 10: 125,066,791 (GRCm39) F283V possibly damaging Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Ubr2 T C 17: 47,283,877 (GRCm39) I591V probably benign Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Zfp608 T C 18: 55,031,126 (GRCm39) Y938C probably damaging Het
Other mutations in Ercc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Ercc4 APN 16 12,943,233 (GRCm39) missense possibly damaging 0.91
IGL00805:Ercc4 APN 16 12,939,868 (GRCm39) missense possibly damaging 0.77
IGL01348:Ercc4 APN 16 12,950,798 (GRCm39) missense probably damaging 1.00
IGL02406:Ercc4 APN 16 12,941,400 (GRCm39) missense probably damaging 1.00
IGL03248:Ercc4 APN 16 12,945,457 (GRCm39) missense probably damaging 1.00
Rapscallion UTSW 16 12,944,331 (GRCm39) missense probably benign
Rascal UTSW 16 12,950,811 (GRCm39) missense probably damaging 1.00
PIT4812001:Ercc4 UTSW 16 12,962,311 (GRCm39) missense probably benign 0.29
R0212:Ercc4 UTSW 16 12,941,196 (GRCm39) critical splice acceptor site probably null
R0505:Ercc4 UTSW 16 12,944,331 (GRCm39) missense probably benign
R0962:Ercc4 UTSW 16 12,948,010 (GRCm39) missense probably damaging 0.99
R1078:Ercc4 UTSW 16 12,948,061 (GRCm39) missense probably benign 0.00
R1356:Ercc4 UTSW 16 12,943,146 (GRCm39) missense probably damaging 0.99
R1420:Ercc4 UTSW 16 12,948,073 (GRCm39) missense probably benign 0.01
R1899:Ercc4 UTSW 16 12,965,651 (GRCm39) missense probably damaging 1.00
R2128:Ercc4 UTSW 16 12,965,798 (GRCm39) missense probably damaging 0.99
R2214:Ercc4 UTSW 16 12,927,888 (GRCm39) missense probably damaging 1.00
R3757:Ercc4 UTSW 16 12,962,360 (GRCm39) missense probably benign 0.28
R4072:Ercc4 UTSW 16 12,948,549 (GRCm39) missense probably damaging 1.00
R4073:Ercc4 UTSW 16 12,948,549 (GRCm39) missense probably damaging 1.00
R4075:Ercc4 UTSW 16 12,948,549 (GRCm39) missense probably damaging 1.00
R4076:Ercc4 UTSW 16 12,948,549 (GRCm39) missense probably damaging 1.00
R4646:Ercc4 UTSW 16 12,965,438 (GRCm39) missense probably damaging 1.00
R4731:Ercc4 UTSW 16 12,965,471 (GRCm39) missense probably damaging 1.00
R4756:Ercc4 UTSW 16 12,941,287 (GRCm39) missense probably damaging 1.00
R4767:Ercc4 UTSW 16 12,939,959 (GRCm39) missense probably damaging 1.00
R5011:Ercc4 UTSW 16 12,941,445 (GRCm39) intron probably benign
R5013:Ercc4 UTSW 16 12,941,445 (GRCm39) intron probably benign
R5301:Ercc4 UTSW 16 12,948,550 (GRCm39) missense probably damaging 1.00
R5308:Ercc4 UTSW 16 12,948,028 (GRCm39) missense probably damaging 1.00
R5684:Ercc4 UTSW 16 12,948,465 (GRCm39) missense probably benign 0.35
R6083:Ercc4 UTSW 16 12,927,903 (GRCm39) nonsense probably null
R6092:Ercc4 UTSW 16 12,943,125 (GRCm39) missense probably benign 0.04
R6815:Ercc4 UTSW 16 12,941,299 (GRCm39) missense probably damaging 0.99
R6953:Ercc4 UTSW 16 12,948,550 (GRCm39) missense probably damaging 1.00
R7062:Ercc4 UTSW 16 12,950,811 (GRCm39) missense probably damaging 1.00
R7199:Ercc4 UTSW 16 12,965,657 (GRCm39) missense probably damaging 1.00
R7317:Ercc4 UTSW 16 12,939,977 (GRCm39) missense probably benign 0.12
R7858:Ercc4 UTSW 16 12,943,169 (GRCm39) missense probably damaging 0.98
R7948:Ercc4 UTSW 16 12,948,049 (GRCm39) missense probably benign 0.00
R8245:Ercc4 UTSW 16 12,948,001 (GRCm39) missense probably benign 0.00
R8408:Ercc4 UTSW 16 12,948,001 (GRCm39) missense probably benign 0.00
R8409:Ercc4 UTSW 16 12,948,001 (GRCm39) missense probably benign 0.00
R9173:Ercc4 UTSW 16 12,939,973 (GRCm39) missense possibly damaging 0.82
R9445:Ercc4 UTSW 16 12,945,474 (GRCm39) missense probably benign
R9696:Ercc4 UTSW 16 12,950,810 (GRCm39) missense probably damaging 1.00
RF007:Ercc4 UTSW 16 12,941,371 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTAACGGCAGCAGCTCAGAAGG -3'
(R):5'- GGTCAAACTCAATGAGCAGCACAGG -3'

Sequencing Primer
(F):5'- AATTTGGGGGAAACTACCTCTGC -3'
(R):5'- GCCTCCGGTAGTAGCGAG -3'
Posted On 2014-04-13