Incidental Mutation 'R1554:Mapk8ip3'
ID170190
Institutional Source Beutler Lab
Gene Symbol Mapk8ip3
Ensembl Gene ENSMUSG00000024163
Gene Namemitogen-activated protein kinase 8 interacting protein 3
SynonymsJSAP1, Syd2, JNK-interacting protein 3, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, D17Wsu15e, Jip3, JSAP1a, JSAP1b, JSAP1c, sunday driver 2, JSAP1d, JUN/SAPK-associated protein 1
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24892153-24936977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24903059 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 710 (D710G)
Ref Sequence ENSEMBL: ENSMUSP00000112955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000119115] [ENSMUST00000120035] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000146706] [ENSMUST00000178969] [ENSMUST00000146923]
Predicted Effect probably benign
Transcript: ENSMUST00000088345
AA Change: D742G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163
AA Change: D742G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115228
AA Change: D727G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163
AA Change: D727G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115229
AA Change: D750G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163
AA Change: D750G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117509
AA Change: D719G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163
AA Change: D719G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119115
AA Change: D710G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163
AA Change: D710G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120035
AA Change: D741G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163
AA Change: D741G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121723
AA Change: D711G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163
AA Change: D711G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121787
AA Change: D705G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163
AA Change: D705G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145357
Predicted Effect probably benign
Transcript: ENSMUST00000146706
SMART Domains Protein: ENSMUSP00000118422
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
Pfam:JIP_LZII 203 235 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178969
AA Change: D742G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163
AA Change: D742G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146923
AA Change: D742G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163
AA Change: D742G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147109
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the product of Drosophila syd gene, required for the functional interaction of kinesin I with axonal cargo. Studies of the similar gene in mouse suggested that this protein may interact with, and regulate the activity of numerous protein kinases of the JNK signaling pathway, and thus function as a scaffold protein in neuronal cells. The C. elegans counterpart of this gene is found to regulate synaptic vesicle transport possibly by integrating JNK signaling and kinesin-1 transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in impaired lung morphogenesis, causes absence of the telencephalic commissure with multiple defects in brain development and axon guidance, may affect synaptic transmission, and invariably leads to neonatal death due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Mapk8ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Mapk8ip3 APN 17 24900819 missense probably damaging 1.00
IGL01018:Mapk8ip3 APN 17 24899719 splice site probably benign
IGL01066:Mapk8ip3 APN 17 24901718 missense probably benign 0.00
IGL01656:Mapk8ip3 APN 17 24918029 missense probably damaging 0.99
IGL01991:Mapk8ip3 APN 17 24927861 missense possibly damaging 0.78
IGL02014:Mapk8ip3 APN 17 24903280 splice site probably benign
IGL02219:Mapk8ip3 APN 17 24899558 missense probably damaging 1.00
IGL03006:Mapk8ip3 APN 17 24901515 missense probably benign
ANU74:Mapk8ip3 UTSW 17 24900577 missense possibly damaging 0.94
FR4737:Mapk8ip3 UTSW 17 24902119 splice site probably null
R0028:Mapk8ip3 UTSW 17 24904897 splice site probably benign
R0401:Mapk8ip3 UTSW 17 24909171 intron probably benign
R0496:Mapk8ip3 UTSW 17 24914450 splice site probably benign
R1456:Mapk8ip3 UTSW 17 24906949 missense probably damaging 1.00
R1503:Mapk8ip3 UTSW 17 24904923 missense probably damaging 1.00
R1680:Mapk8ip3 UTSW 17 24901011 missense probably damaging 1.00
R1733:Mapk8ip3 UTSW 17 24936850 missense possibly damaging 0.70
R1741:Mapk8ip3 UTSW 17 24899854 missense probably damaging 1.00
R1750:Mapk8ip3 UTSW 17 24914459 missense probably null 1.00
R1774:Mapk8ip3 UTSW 17 24924145 critical splice donor site probably null
R1845:Mapk8ip3 UTSW 17 24914583 missense probably benign 0.29
R1911:Mapk8ip3 UTSW 17 24904051 missense probably benign 0.00
R1993:Mapk8ip3 UTSW 17 24914588 missense probably damaging 1.00
R2512:Mapk8ip3 UTSW 17 24914703 nonsense probably null
R2656:Mapk8ip3 UTSW 17 24912807 missense probably damaging 1.00
R2990:Mapk8ip3 UTSW 17 24905292 missense probably benign 0.00
R4587:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4617:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4627:Mapk8ip3 UTSW 17 24903293 missense probably benign
R4649:Mapk8ip3 UTSW 17 24904752 missense probably damaging 1.00
R4868:Mapk8ip3 UTSW 17 24901415 missense probably benign 0.04
R4903:Mapk8ip3 UTSW 17 24901209 missense probably benign
R4915:Mapk8ip3 UTSW 17 24909153 missense possibly damaging 0.75
R5447:Mapk8ip3 UTSW 17 24899189 missense probably benign
R5642:Mapk8ip3 UTSW 17 24903311 missense possibly damaging 0.63
R6320:Mapk8ip3 UTSW 17 24906905 missense probably damaging 0.99
R6900:Mapk8ip3 UTSW 17 24909123 splice site probably null
R7178:Mapk8ip3 UTSW 17 24901754 missense probably benign 0.02
R7273:Mapk8ip3 UTSW 17 24906174 missense probably benign 0.00
R7317:Mapk8ip3 UTSW 17 24901718 missense probably benign 0.00
R7323:Mapk8ip3 UTSW 17 24901161 missense probably benign
R7701:Mapk8ip3 UTSW 17 24901404 missense possibly damaging 0.93
R7873:Mapk8ip3 UTSW 17 24906172 missense probably benign 0.01
R8070:Mapk8ip3 UTSW 17 24901104 critical splice donor site probably null
R8314:Mapk8ip3 UTSW 17 24901774 missense probably benign 0.09
R8356:Mapk8ip3 UTSW 17 24904951 missense probably damaging 1.00
R8441:Mapk8ip3 UTSW 17 24920500 intron probably benign
R8537:Mapk8ip3 UTSW 17 24901678 nonsense probably null
R8802:Mapk8ip3 UTSW 17 24905232 missense probably damaging 1.00
R8864:Mapk8ip3 UTSW 17 24899518 missense probably damaging 1.00
R8918:Mapk8ip3 UTSW 17 24912753 missense probably damaging 1.00
X0024:Mapk8ip3 UTSW 17 24903973 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGCAAATCACTGGGCCTCTCC -3'
(R):5'- CCAGAGAAGCTGATGCACTGAGAC -3'

Sequencing Primer
(F):5'- CTCTGTTACCAAGGGCAGTAGAC -3'
(R):5'- TGATGCACTGAGACCTCACAG -3'
Posted On2014-04-13