Incidental Mutation 'R1554:Ubr2'
ID 170192
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms ENSMUSG00000043296, E130209G04Rik, 9930021A08Rik
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.872) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 47239221-47321482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47283877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 591 (I591V)
Ref Sequence ENSEMBL: ENSMUSP00000108963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]
AlphaFold Q6WKZ8
Predicted Effect probably benign
Transcript: ENSMUST00000113335
AA Change: I591V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: I591V

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113337
AA Change: I591V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: I591V

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224759
Predicted Effect probably benign
Transcript: ENSMUST00000225599
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Btaf1 A G 19: 36,973,998 (GRCm39) D1390G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Dtx1 T C 5: 120,821,386 (GRCm39) K387R probably damaging Het
Ercc4 A G 16: 12,965,486 (GRCm39) D706G probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Pfkfb2 A G 1: 130,634,209 (GRCm39) V156A probably damaging Het
Ppp4r3a A T 12: 101,022,081 (GRCm39) D307E probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc16a7 A C 10: 125,066,791 (GRCm39) F283V possibly damaging Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Zfp608 T C 18: 55,031,126 (GRCm39) Y938C probably damaging Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 47,296,986 (GRCm39) splice site probably benign
IGL00332:Ubr2 APN 17 47,301,916 (GRCm39) critical splice donor site probably null
IGL00518:Ubr2 APN 17 47,303,922 (GRCm39) missense probably damaging 1.00
IGL00693:Ubr2 APN 17 47,283,907 (GRCm39) missense probably benign 0.01
IGL00785:Ubr2 APN 17 47,255,791 (GRCm39) missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 47,268,247 (GRCm39) missense probably damaging 1.00
IGL01459:Ubr2 APN 17 47,241,435 (GRCm39) splice site probably benign
IGL01637:Ubr2 APN 17 47,267,580 (GRCm39) missense probably damaging 1.00
IGL01710:Ubr2 APN 17 47,254,335 (GRCm39) missense probably benign 0.00
IGL01726:Ubr2 APN 17 47,303,907 (GRCm39) splice site probably benign
IGL01925:Ubr2 APN 17 47,265,875 (GRCm39) missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 47,284,893 (GRCm39) missense probably benign 0.45
IGL02170:Ubr2 APN 17 47,278,123 (GRCm39) missense probably benign 0.05
IGL02308:Ubr2 APN 17 47,245,119 (GRCm39) missense probably damaging 1.00
IGL02387:Ubr2 APN 17 47,274,076 (GRCm39) missense probably benign
IGL02696:Ubr2 APN 17 47,274,691 (GRCm39) missense probably benign
IGL02726:Ubr2 APN 17 47,283,847 (GRCm39) missense probably damaging 1.00
IGL02750:Ubr2 APN 17 47,280,208 (GRCm39) missense probably benign 0.00
IGL02934:Ubr2 APN 17 47,268,266 (GRCm39) missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 47,286,877 (GRCm39) missense probably damaging 0.96
IGL03018:Ubr2 APN 17 47,264,972 (GRCm39) missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 47,262,844 (GRCm39) missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 47,255,789 (GRCm39) missense probably damaging 1.00
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0446:Ubr2 UTSW 17 47,294,224 (GRCm39) missense probably damaging 1.00
R0513:Ubr2 UTSW 17 47,297,705 (GRCm39) nonsense probably null
R0565:Ubr2 UTSW 17 47,266,812 (GRCm39) missense probably damaging 1.00
R0600:Ubr2 UTSW 17 47,278,174 (GRCm39) missense probably damaging 0.99
R0690:Ubr2 UTSW 17 47,249,579 (GRCm39) missense probably damaging 0.97
R0710:Ubr2 UTSW 17 47,249,607 (GRCm39) missense probably damaging 0.96
R0761:Ubr2 UTSW 17 47,294,242 (GRCm39) missense probably damaging 1.00
R0798:Ubr2 UTSW 17 47,280,102 (GRCm39) splice site probably benign
R0862:Ubr2 UTSW 17 47,278,009 (GRCm39) nonsense probably null
R0947:Ubr2 UTSW 17 47,252,038 (GRCm39) missense probably damaging 0.99
R0972:Ubr2 UTSW 17 47,245,187 (GRCm39) splice site probably null
R1500:Ubr2 UTSW 17 47,297,615 (GRCm39) missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47,311,749 (GRCm39) missense probably damaging 1.00
R1533:Ubr2 UTSW 17 47,278,173 (GRCm39) nonsense probably null
R1575:Ubr2 UTSW 17 47,243,418 (GRCm39) missense probably damaging 1.00
R1602:Ubr2 UTSW 17 47,251,987 (GRCm39) missense probably benign 0.30
R1941:Ubr2 UTSW 17 47,284,952 (GRCm39) missense probably damaging 1.00
R1966:Ubr2 UTSW 17 47,265,845 (GRCm39) missense probably benign 0.05
R2041:Ubr2 UTSW 17 47,296,973 (GRCm39) missense probably damaging 1.00
R2067:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2111:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2189:Ubr2 UTSW 17 47,254,290 (GRCm39) missense probably benign 0.01
R2219:Ubr2 UTSW 17 47,296,968 (GRCm39) missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 47,277,141 (GRCm39) nonsense probably null
R3426:Ubr2 UTSW 17 47,279,365 (GRCm39) missense probably damaging 1.00
R3428:Ubr2 UTSW 17 47,279,365 (GRCm39) missense probably damaging 1.00
R3608:Ubr2 UTSW 17 47,255,449 (GRCm39) missense probably damaging 1.00
R4080:Ubr2 UTSW 17 47,299,648 (GRCm39) missense probably benign 0.05
R4330:Ubr2 UTSW 17 47,278,204 (GRCm39) missense probably null 1.00
R4383:Ubr2 UTSW 17 47,250,313 (GRCm39) missense probably benign 0.01
R4460:Ubr2 UTSW 17 47,255,971 (GRCm39) critical splice donor site probably null
R4794:Ubr2 UTSW 17 47,241,371 (GRCm39) missense probably damaging 1.00
R4902:Ubr2 UTSW 17 47,296,922 (GRCm39) missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 47,270,385 (GRCm39) splice site probably null
R5092:Ubr2 UTSW 17 47,280,173 (GRCm39) missense probably damaging 1.00
R5209:Ubr2 UTSW 17 47,279,350 (GRCm39) missense probably damaging 1.00
R5226:Ubr2 UTSW 17 47,294,196 (GRCm39) missense probably benign 0.04
R5250:Ubr2 UTSW 17 47,241,368 (GRCm39) missense probably benign 0.01
R5437:Ubr2 UTSW 17 47,274,623 (GRCm39) missense probably benign 0.00
R5607:Ubr2 UTSW 17 47,245,126 (GRCm39) nonsense probably null
R5848:Ubr2 UTSW 17 47,267,581 (GRCm39) missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 47,293,218 (GRCm39) missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 47,268,241 (GRCm39) missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 47,277,194 (GRCm39) splice site probably null
R6630:Ubr2 UTSW 17 47,262,910 (GRCm39) missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 47,245,034 (GRCm39) missense probably damaging 0.99
R6936:Ubr2 UTSW 17 47,283,957 (GRCm39) missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47,321,139 (GRCm39) missense probably benign 0.01
R7050:Ubr2 UTSW 17 47,272,528 (GRCm39) missense probably benign 0.30
R7078:Ubr2 UTSW 17 47,266,779 (GRCm39) missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 47,284,982 (GRCm39) splice site probably null
R7219:Ubr2 UTSW 17 47,246,360 (GRCm39) nonsense probably null
R7262:Ubr2 UTSW 17 47,311,665 (GRCm39) missense probably damaging 0.97
R7352:Ubr2 UTSW 17 47,241,352 (GRCm39) missense probably benign 0.19
R7366:Ubr2 UTSW 17 47,266,771 (GRCm39) missense probably damaging 0.99
R7449:Ubr2 UTSW 17 47,275,714 (GRCm39) missense probably damaging 1.00
R7496:Ubr2 UTSW 17 47,301,917 (GRCm39) critical splice donor site probably null
R7759:Ubr2 UTSW 17 47,296,974 (GRCm39) missense probably damaging 1.00
R7869:Ubr2 UTSW 17 47,301,934 (GRCm39) missense probably benign 0.00
R7916:Ubr2 UTSW 17 47,279,308 (GRCm39) critical splice donor site probably null
R8236:Ubr2 UTSW 17 47,262,835 (GRCm39) missense probably benign
R8376:Ubr2 UTSW 17 47,253,721 (GRCm39) missense probably benign 0.07
R9026:Ubr2 UTSW 17 47,245,041 (GRCm39) missense probably damaging 1.00
R9216:Ubr2 UTSW 17 47,292,285 (GRCm39) missense probably benign 0.36
R9339:Ubr2 UTSW 17 47,284,865 (GRCm39) missense probably benign 0.30
R9558:Ubr2 UTSW 17 47,262,843 (GRCm39) missense probably benign
R9606:Ubr2 UTSW 17 47,245,020 (GRCm39) missense probably damaging 1.00
R9644:Ubr2 UTSW 17 47,266,706 (GRCm39) critical splice donor site probably null
R9731:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
X0027:Ubr2 UTSW 17 47,311,555 (GRCm39) missense probably damaging 0.99
X0061:Ubr2 UTSW 17 47,281,037 (GRCm39) missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 47,311,692 (GRCm39) missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47,270,435 (GRCm39) missense probably benign
Z1177:Ubr2 UTSW 17 47,321,069 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTGTGCCCAATCGTCTCAAAATGC -3'
(R):5'- TGGCAGAAATGCCTTTGGGTTACTG -3'

Sequencing Primer
(F):5'- tctatgcctctgtcctccc -3'
(R):5'- TGTCACTTTGACTAGACGAGACAG -3'
Posted On 2014-04-13