Incidental Mutation 'R1554:Sap130'
ID170193
Institutional Source Beutler Lab
Gene Symbol Sap130
Ensembl Gene ENSMUSG00000024260
Gene NameSin3A associated protein
Synonyms2610304F09Rik
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location31634371-31723061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31666472 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 334 (L334P)
Ref Sequence ENSEMBL: ENSMUSP00000136842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025109] [ENSMUST00000178164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025109
AA Change: L334P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025109
Gene: ENSMUSG00000024260
AA Change: L334P

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
low complexity region 716 748 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 894 904 N/A INTRINSIC
low complexity region 1044 1056 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178164
AA Change: L334P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136842
Gene: ENSMUSG00000024260
AA Change: L334P

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
Pfam:SAP130_C 635 1040 5.4e-224 PFAM
low complexity region 1045 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAP130 is a subunit of the histone deacetylase (see HDAC1; MIM 601241)-dependent SIN3A (MIM 607776) corepressor complex (Fleischer et al., 2003 [PubMed 12724404]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a transposon insertion are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Sap130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Sap130 APN 18 31698766 missense probably benign 0.00
IGL01060:Sap130 APN 18 31715443 missense probably damaging 1.00
IGL01668:Sap130 APN 18 31680440 missense probably damaging 0.97
IGL01797:Sap130 APN 18 31698668 missense probably damaging 0.98
IGL01872:Sap130 APN 18 31674420 missense probably damaging 0.98
IGL02010:Sap130 APN 18 31649602 missense probably damaging 0.98
PIT4142001:Sap130 UTSW 18 31667011 critical splice donor site probably null
PIT4366001:Sap130 UTSW 18 31677409 missense probably benign 0.06
R0083:Sap130 UTSW 18 31666329 splice site probably benign
R0083:Sap130 UTSW 18 31711641 missense probably damaging 1.00
R0243:Sap130 UTSW 18 31680681 splice site probably benign
R0255:Sap130 UTSW 18 31680506 missense probably damaging 1.00
R0704:Sap130 UTSW 18 31653554 missense probably damaging 0.99
R1069:Sap130 UTSW 18 31711629 missense probably damaging 0.96
R1086:Sap130 UTSW 18 31650620 splice site probably benign
R1162:Sap130 UTSW 18 31648173 missense probably damaging 1.00
R1478:Sap130 UTSW 18 31680474 missense possibly damaging 0.95
R1484:Sap130 UTSW 18 31711327 missense probably damaging 1.00
R1625:Sap130 UTSW 18 31674464 missense probably damaging 0.99
R1771:Sap130 UTSW 18 31636082 missense probably benign 0.10
R1793:Sap130 UTSW 18 31698587 missense probably benign 0.10
R1905:Sap130 UTSW 18 31680567 missense possibly damaging 0.67
R2026:Sap130 UTSW 18 31698574 missense possibly damaging 0.81
R2074:Sap130 UTSW 18 31648279 missense probably damaging 0.99
R2174:Sap130 UTSW 18 31677479 critical splice donor site probably null
R3927:Sap130 UTSW 18 31674382 missense possibly damaging 0.95
R4454:Sap130 UTSW 18 31711360 missense probably damaging 1.00
R4980:Sap130 UTSW 18 31649646 missense possibly damaging 0.95
R5222:Sap130 UTSW 18 31666703 missense probably damaging 1.00
R5345:Sap130 UTSW 18 31648198 missense probably benign 0.32
R5811:Sap130 UTSW 18 31689442 missense probably benign 0.01
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6129:Sap130 UTSW 18 31682091 missense possibly damaging 0.94
R6431:Sap130 UTSW 18 31666365 missense possibly damaging 0.95
R6930:Sap130 UTSW 18 31682088 missense possibly damaging 0.94
R6932:Sap130 UTSW 18 31666354 missense possibly damaging 0.88
R7454:Sap130 UTSW 18 31650512 missense probably benign 0.01
R7510:Sap130 UTSW 18 31667004 missense probably damaging 1.00
R7510:Sap130 UTSW 18 31711215 missense probably damaging 0.99
R7641:Sap130 UTSW 18 31653623 missense probably damaging 0.99
R7870:Sap130 UTSW 18 31720661 missense probably benign 0.15
X0021:Sap130 UTSW 18 31647076 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTGAAGCAAGATGGCAACCAGC -3'
(R):5'- TTCTGTGAGGGGACCCCATAACAC -3'

Sequencing Primer
(F):5'- GGACAAGATGCCTTCTTTGAC -3'
(R):5'- GGGGACCCCATAACACAGTTATAC -3'
Posted On2014-04-13