Incidental Mutation 'R1554:Zfp608'
ID 170195
Institutional Source Beutler Lab
Gene Symbol Zfp608
Ensembl Gene ENSMUSG00000052713
Gene Name zinc finger protein 608
Synonyms 4932417D18Rik
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 55021120-55125627 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55031126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 938 (Y938C)
Ref Sequence ENSEMBL: ENSMUSP00000068192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064763]
AlphaFold Q56A10
Predicted Effect probably damaging
Transcript: ENSMUST00000064763
AA Change: Y938C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068192
Gene: ENSMUSG00000052713
AA Change: Y938C

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 459 471 N/A INTRINSIC
ZnF_C2H2 552 577 1.86e0 SMART
low complexity region 624 636 N/A INTRINSIC
low complexity region 706 718 N/A INTRINSIC
low complexity region 734 773 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 833 846 N/A INTRINSIC
low complexity region 934 956 N/A INTRINSIC
coiled coil region 1028 1054 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1255 1268 N/A INTRINSIC
low complexity region 1439 1450 N/A INTRINSIC
low complexity region 1458 1466 N/A INTRINSIC
low complexity region 1486 1502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Btaf1 A G 19: 36,973,998 (GRCm39) D1390G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Dtx1 T C 5: 120,821,386 (GRCm39) K387R probably damaging Het
Ercc4 A G 16: 12,965,486 (GRCm39) D706G probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Pfkfb2 A G 1: 130,634,209 (GRCm39) V156A probably damaging Het
Ppp4r3a A T 12: 101,022,081 (GRCm39) D307E probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc16a7 A C 10: 125,066,791 (GRCm39) F283V possibly damaging Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Ubr2 T C 17: 47,283,877 (GRCm39) I591V probably benign Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Other mutations in Zfp608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Zfp608 APN 18 55,121,405 (GRCm39) missense probably benign
IGL00920:Zfp608 APN 18 55,022,903 (GRCm39) missense probably benign 0.00
IGL01088:Zfp608 APN 18 55,031,159 (GRCm39) missense probably benign 0.03
IGL01447:Zfp608 APN 18 55,032,083 (GRCm39) missense possibly damaging 0.75
IGL01534:Zfp608 APN 18 55,032,004 (GRCm39) missense probably damaging 0.99
IGL01547:Zfp608 APN 18 55,027,521 (GRCm39) critical splice donor site probably null
IGL01933:Zfp608 APN 18 55,120,871 (GRCm39) missense probably benign
IGL01998:Zfp608 APN 18 55,024,890 (GRCm39) missense probably damaging 0.99
IGL02167:Zfp608 APN 18 55,121,296 (GRCm39) missense probably damaging 1.00
IGL02266:Zfp608 APN 18 55,030,653 (GRCm39) missense probably benign 0.08
IGL02335:Zfp608 APN 18 55,030,509 (GRCm39) nonsense probably null
IGL02455:Zfp608 APN 18 55,032,405 (GRCm39) missense probably damaging 1.00
IGL02612:Zfp608 APN 18 55,031,273 (GRCm39) missense probably damaging 1.00
IGL02900:Zfp608 APN 18 55,079,865 (GRCm39) missense probably damaging 1.00
PIT4243001:Zfp608 UTSW 18 55,031,096 (GRCm39) missense probably damaging 1.00
PIT4519001:Zfp608 UTSW 18 55,079,783 (GRCm39) missense possibly damaging 0.71
R0005:Zfp608 UTSW 18 55,028,592 (GRCm39) missense possibly damaging 0.88
R0010:Zfp608 UTSW 18 55,028,286 (GRCm39) splice site probably benign
R0010:Zfp608 UTSW 18 55,028,286 (GRCm39) splice site probably benign
R0064:Zfp608 UTSW 18 55,031,888 (GRCm39) missense probably benign
R0401:Zfp608 UTSW 18 55,032,066 (GRCm39) missense probably benign
R0722:Zfp608 UTSW 18 55,033,306 (GRCm39) missense probably damaging 1.00
R1351:Zfp608 UTSW 18 55,031,463 (GRCm39) missense probably benign 0.00
R1512:Zfp608 UTSW 18 55,079,738 (GRCm39) missense probably damaging 1.00
R1622:Zfp608 UTSW 18 55,121,366 (GRCm39) missense probably benign 0.07
R1669:Zfp608 UTSW 18 55,120,811 (GRCm39) missense probably benign 0.09
R1690:Zfp608 UTSW 18 55,120,706 (GRCm39) missense possibly damaging 0.62
R1721:Zfp608 UTSW 18 55,032,321 (GRCm39) missense probably benign
R1826:Zfp608 UTSW 18 55,031,648 (GRCm39) missense probably benign 0.03
R1864:Zfp608 UTSW 18 55,030,983 (GRCm39) missense probably benign 0.00
R1952:Zfp608 UTSW 18 55,030,851 (GRCm39) nonsense probably null
R2049:Zfp608 UTSW 18 55,028,637 (GRCm39) missense probably damaging 1.00
R2051:Zfp608 UTSW 18 55,121,386 (GRCm39) missense probably benign
R2168:Zfp608 UTSW 18 55,031,125 (GRCm39) nonsense probably null
R2218:Zfp608 UTSW 18 55,120,756 (GRCm39) missense probably benign 0.14
R2283:Zfp608 UTSW 18 55,121,446 (GRCm39) missense probably damaging 1.00
R2399:Zfp608 UTSW 18 55,030,974 (GRCm39) missense probably damaging 1.00
R2520:Zfp608 UTSW 18 55,121,578 (GRCm39) missense possibly damaging 0.92
R2961:Zfp608 UTSW 18 55,031,544 (GRCm39) missense possibly damaging 0.60
R4074:Zfp608 UTSW 18 55,031,180 (GRCm39) missense probably damaging 1.00
R4076:Zfp608 UTSW 18 55,031,180 (GRCm39) missense probably damaging 1.00
R4206:Zfp608 UTSW 18 55,121,267 (GRCm39) missense probably damaging 1.00
R4756:Zfp608 UTSW 18 55,027,544 (GRCm39) missense probably damaging 1.00
R4771:Zfp608 UTSW 18 55,121,372 (GRCm39) missense probably benign
R4820:Zfp608 UTSW 18 55,120,756 (GRCm39) missense probably benign 0.14
R4825:Zfp608 UTSW 18 55,031,041 (GRCm39) missense probably benign 0.01
R4912:Zfp608 UTSW 18 55,079,663 (GRCm39) missense probably damaging 1.00
R4975:Zfp608 UTSW 18 55,022,962 (GRCm39) missense probably damaging 1.00
R5138:Zfp608 UTSW 18 55,024,871 (GRCm39) missense probably damaging 1.00
R5192:Zfp608 UTSW 18 55,031,569 (GRCm39) missense probably damaging 1.00
R5557:Zfp608 UTSW 18 55,120,942 (GRCm39) missense possibly damaging 0.81
R5624:Zfp608 UTSW 18 55,031,344 (GRCm39) missense probably damaging 1.00
R5818:Zfp608 UTSW 18 55,028,468 (GRCm39) missense probably benign 0.02
R5840:Zfp608 UTSW 18 55,031,978 (GRCm39) missense probably damaging 1.00
R5992:Zfp608 UTSW 18 55,032,320 (GRCm39) missense probably benign 0.15
R6106:Zfp608 UTSW 18 55,120,944 (GRCm39) missense possibly damaging 0.54
R6174:Zfp608 UTSW 18 55,121,616 (GRCm39) start gained probably benign
R6181:Zfp608 UTSW 18 55,028,700 (GRCm39) missense possibly damaging 0.56
R6517:Zfp608 UTSW 18 55,032,150 (GRCm39) missense possibly damaging 0.94
R6567:Zfp608 UTSW 18 55,030,628 (GRCm39) missense probably damaging 1.00
R6668:Zfp608 UTSW 18 55,031,091 (GRCm39) missense probably damaging 1.00
R6920:Zfp608 UTSW 18 55,121,337 (GRCm39) missense probably damaging 1.00
R7061:Zfp608 UTSW 18 55,121,069 (GRCm39) missense probably benign
R7074:Zfp608 UTSW 18 55,030,454 (GRCm39) missense possibly damaging 0.69
R7087:Zfp608 UTSW 18 55,032,469 (GRCm39) missense probably damaging 1.00
R7391:Zfp608 UTSW 18 55,030,619 (GRCm39) missense possibly damaging 0.49
R7600:Zfp608 UTSW 18 55,121,092 (GRCm39) missense probably damaging 1.00
R7723:Zfp608 UTSW 18 55,030,673 (GRCm39) missense probably damaging 1.00
R8054:Zfp608 UTSW 18 55,032,618 (GRCm39) missense probably benign 0.28
R8236:Zfp608 UTSW 18 55,032,281 (GRCm39) missense probably damaging 1.00
R8260:Zfp608 UTSW 18 55,030,821 (GRCm39) missense possibly damaging 0.60
R8732:Zfp608 UTSW 18 55,121,072 (GRCm39) missense probably benign 0.06
R8781:Zfp608 UTSW 18 55,031,801 (GRCm39) missense probably damaging 1.00
R8851:Zfp608 UTSW 18 55,032,194 (GRCm39) missense possibly damaging 0.94
R8940:Zfp608 UTSW 18 55,033,301 (GRCm39) missense possibly damaging 0.93
R9051:Zfp608 UTSW 18 55,032,266 (GRCm39) missense probably damaging 1.00
R9091:Zfp608 UTSW 18 55,032,190 (GRCm39) missense probably damaging 1.00
R9092:Zfp608 UTSW 18 55,031,648 (GRCm39) missense probably benign 0.03
R9236:Zfp608 UTSW 18 55,032,354 (GRCm39) missense probably benign 0.39
R9270:Zfp608 UTSW 18 55,032,190 (GRCm39) missense probably damaging 1.00
R9283:Zfp608 UTSW 18 55,030,913 (GRCm39) missense possibly damaging 0.50
R9288:Zfp608 UTSW 18 55,033,341 (GRCm39) missense probably benign 0.39
R9463:Zfp608 UTSW 18 55,030,274 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGTAATAAAGTGACTGAGCCAGG -3'
(R):5'- GTTTACACATTCACGGACAATGCCC -3'

Sequencing Primer
(F):5'- AAGTATGGTCTACTTTCTTGGACTC -3'
(R):5'- GGACAATGCCCCCAGCC -3'
Posted On 2014-04-13