Incidental Mutation 'R1554:Btaf1'
ID 170199
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene Name B-TFIID TATA-box binding protein associated factor 1
Synonyms E430027O22Rik
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 36903479-36990152 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36973998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1390 (D1390G)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
AlphaFold E9QAE3
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: D1390G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: D1390G

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Dtx1 T C 5: 120,821,386 (GRCm39) K387R probably damaging Het
Ercc4 A G 16: 12,965,486 (GRCm39) D706G probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Pfkfb2 A G 1: 130,634,209 (GRCm39) V156A probably damaging Het
Ppp4r3a A T 12: 101,022,081 (GRCm39) D307E probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc16a7 A C 10: 125,066,791 (GRCm39) F283V possibly damaging Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Ubr2 T C 17: 47,283,877 (GRCm39) I591V probably benign Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Zfp608 T C 18: 55,031,126 (GRCm39) Y938C probably damaging Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 36,987,102 (GRCm39) missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36,974,935 (GRCm39) missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36,947,330 (GRCm39) missense probably benign 0.00
IGL00969:Btaf1 APN 19 36,988,652 (GRCm39) splice site probably benign
IGL01325:Btaf1 APN 19 36,982,049 (GRCm39) splice site probably benign
IGL01399:Btaf1 APN 19 36,977,570 (GRCm39) nonsense probably null
IGL02024:Btaf1 APN 19 36,969,826 (GRCm39) splice site probably benign
IGL02471:Btaf1 APN 19 36,977,592 (GRCm39) missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36,955,828 (GRCm39) splice site probably benign
IGL02898:Btaf1 APN 19 36,946,468 (GRCm39) missense probably benign
IGL02995:Btaf1 APN 19 36,958,535 (GRCm39) splice site probably benign
IGL03023:Btaf1 APN 19 36,987,415 (GRCm39) missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36,926,508 (GRCm39) missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36,969,900 (GRCm39) missense probably damaging 1.00
freudenberg UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
Galanos UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
3-1:Btaf1 UTSW 19 36,987,478 (GRCm39) missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36,935,773 (GRCm39) missense probably benign
R0048:Btaf1 UTSW 19 36,980,924 (GRCm39) missense probably benign 0.01
R0117:Btaf1 UTSW 19 36,947,368 (GRCm39) missense probably benign 0.06
R0207:Btaf1 UTSW 19 36,987,048 (GRCm39) nonsense probably null
R0310:Btaf1 UTSW 19 36,981,934 (GRCm39) missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36,966,402 (GRCm39) missense probably benign
R0419:Btaf1 UTSW 19 36,922,629 (GRCm39) missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36,964,053 (GRCm39) missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36,928,586 (GRCm39) splice site probably benign
R0612:Btaf1 UTSW 19 36,946,537 (GRCm39) missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36,974,895 (GRCm39) splice site probably null
R0780:Btaf1 UTSW 19 36,966,322 (GRCm39) missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36,968,143 (GRCm39) missense probably benign 0.03
R1104:Btaf1 UTSW 19 36,982,002 (GRCm39) missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36,933,924 (GRCm39) missense probably benign 0.10
R1325:Btaf1 UTSW 19 36,946,562 (GRCm39) missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36,969,854 (GRCm39) missense probably benign 0.00
R1649:Btaf1 UTSW 19 36,959,122 (GRCm39) missense probably benign
R1715:Btaf1 UTSW 19 36,946,521 (GRCm39) missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36,972,362 (GRCm39) missense probably benign
R1764:Btaf1 UTSW 19 36,928,518 (GRCm39) missense probably benign 0.12
R1874:Btaf1 UTSW 19 36,957,983 (GRCm39) missense probably benign
R1911:Btaf1 UTSW 19 36,964,030 (GRCm39) missense probably benign
R1933:Btaf1 UTSW 19 36,950,357 (GRCm39) missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36,928,548 (GRCm39) missense probably benign 0.09
R2483:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R2510:Btaf1 UTSW 19 36,979,845 (GRCm39) missense probably benign 0.08
R3623:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3624:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3801:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3801:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3802:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3802:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3803:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3803:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R4077:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4079:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4133:Btaf1 UTSW 19 36,939,138 (GRCm39) missense probably benign 0.00
R4673:Btaf1 UTSW 19 36,955,772 (GRCm39) missense probably benign 0.00
R4731:Btaf1 UTSW 19 36,958,478 (GRCm39) missense probably benign 0.03
R4796:Btaf1 UTSW 19 36,933,828 (GRCm39) missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36,958,448 (GRCm39) missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 36,979,858 (GRCm39) missense probably benign 0.00
R4837:Btaf1 UTSW 19 36,944,185 (GRCm39) missense probably benign
R4925:Btaf1 UTSW 19 36,988,733 (GRCm39) missense probably benign
R4968:Btaf1 UTSW 19 36,947,351 (GRCm39) missense probably null 0.71
R4976:Btaf1 UTSW 19 36,963,979 (GRCm39) missense probably benign
R5001:Btaf1 UTSW 19 36,964,052 (GRCm39) missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 36,980,931 (GRCm39) missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36,968,162 (GRCm39) missense probably benign
R5211:Btaf1 UTSW 19 36,973,962 (GRCm39) missense probably benign 0.32
R5422:Btaf1 UTSW 19 36,928,507 (GRCm39) missense probably benign 0.09
R5429:Btaf1 UTSW 19 36,972,257 (GRCm39) missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36,968,175 (GRCm39) missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
R5654:Btaf1 UTSW 19 36,961,015 (GRCm39) missense probably benign 0.35
R5744:Btaf1 UTSW 19 36,981,890 (GRCm39) missense probably benign 0.02
R6082:Btaf1 UTSW 19 36,960,942 (GRCm39) missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36,958,520 (GRCm39) missense probably benign 0.02
R6291:Btaf1 UTSW 19 36,950,408 (GRCm39) missense probably benign 0.00
R6502:Btaf1 UTSW 19 36,961,017 (GRCm39) missense probably benign
R7034:Btaf1 UTSW 19 36,981,869 (GRCm39) missense probably benign
R7036:Btaf1 UTSW 19 36,981,869 (GRCm39) missense probably benign
R7085:Btaf1 UTSW 19 36,950,318 (GRCm39) missense probably benign
R7097:Btaf1 UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36,922,714 (GRCm39) missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36,935,782 (GRCm39) missense probably benign 0.02
R7402:Btaf1 UTSW 19 36,980,915 (GRCm39) missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36,946,527 (GRCm39) missense probably damaging 1.00
R7493:Btaf1 UTSW 19 36,987,005 (GRCm39) missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36,955,803 (GRCm39) missense probably benign 0.30
R7888:Btaf1 UTSW 19 36,943,036 (GRCm39) missense probably benign 0.10
R7944:Btaf1 UTSW 19 36,926,565 (GRCm39) missense probably benign
R8062:Btaf1 UTSW 19 36,969,865 (GRCm39) missense probably benign 0.00
R8559:Btaf1 UTSW 19 36,964,273 (GRCm39) missense probably benign 0.00
R8793:Btaf1 UTSW 19 36,958,429 (GRCm39) missense probably benign 0.21
R8855:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R8866:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R9016:Btaf1 UTSW 19 36,971,705 (GRCm39) missense probably benign 0.00
R9028:Btaf1 UTSW 19 36,946,508 (GRCm39) missense probably damaging 1.00
R9109:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9172:Btaf1 UTSW 19 36,977,630 (GRCm39) missense probably damaging 0.98
R9298:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9717:Btaf1 UTSW 19 36,922,646 (GRCm39) missense probably benign 0.28
W0251:Btaf1 UTSW 19 36,980,904 (GRCm39) missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36,926,496 (GRCm39) nonsense probably null
Z1088:Btaf1 UTSW 19 36,964,018 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCCAAAAGAAGAGATGCTGACAAA -3'
(R):5'- TCCAGAGCAAAACATCATGTTCCACC -3'

Sequencing Primer
(F):5'- tgggaagcagacgcagg -3'
(R):5'- gcactgactgctctccc -3'
Posted On 2014-04-13