Mutagenetix > Incidental Mutations

Incidental Mutation 'R1555:Spta1'

170204

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

039594-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.816) question?

Stock #

R1555 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

174172776-174248450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 174178749 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 159 (Y159C)

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027817
AA Change: Y159C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: Y159C

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

96% (43/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	A	G	11: 105,974,901		probably null	Het
Adamts1	T	A	16: 85,797,888	T358S	probably benign	Het
Ate1	A	T	7: 130,509,091	F169I	probably benign	Het
Cdkl4	T	A	17: 80,543,614		probably benign	Het
Clcnkb	T	C	4: 141,411,739		probably null	Het
Col6a4	C	T	9: 106,000,886	R1964Q	possibly damaging	Het
Dcakd	C	T	11: 103,000,213	V17I	probably damaging	Het
Dcdc5	T	G	2: 106,384,135		noncoding transcript	Het
Erc2	T	A	14: 28,011,665	D557E	probably damaging	Het
Grid2	A	T	6: 64,429,684	D676V	possibly damaging	Het
Hebp2	G	T	10: 18,544,415	T90K	possibly damaging	Het
Igkv10-96	C	T	6: 68,632,381		probably benign	Het
Mier3	T	A	13: 111,708,359	N248K	probably damaging	Het
Myo5b	A	T	18: 74,569,782	I15F	probably damaging	Het
Neurl3	A	G	1: 36,266,532	V198A	probably benign	Het
Notch2	C	A	3: 98,131,340	N1266K	possibly damaging	Het
Nup107	A	G	10: 117,751,490		probably benign	Het
Olfr214	A	T	6: 116,556,826	I134F	probably damaging	Het
Olfr675	T	C	7: 105,024,522	I153V	probably benign	Het
Phf3	G	T	1: 30,805,877	H1334N	possibly damaging	Het
Phyhd1	T	A	2: 30,274,706	I100N	probably damaging	Het
Rad21l	T	A	2: 151,658,428	T224S	probably benign	Het
Rxra	C	T	2: 27,748,678	A231V	probably benign	Het
Sac3d1	T	C	19: 6,118,405	D61G	probably damaging	Het
Sbf1	A	G	15: 89,305,076	Y481H	probably damaging	Het
Spg11	T	C	2: 122,097,377	E642G	probably damaging	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tedc1	G	T	12: 113,156,497		probably benign	Het
Tmem200a	A	T	10: 25,993,884	D162E	probably damaging	Het
Tmprss11e	T	A	5: 86,715,588	Q206L	probably damaging	Het
Tpra1	A	G	6: 88,910,203	N175S	probably damaging	Het
Ttll10	T	C	4: 156,035,139	E601G	probably benign	Het
Ttll6	G	T	11: 96,145,582	D346Y	probably damaging	Het
U2surp	A	G	9: 95,466,577	V874A	probably damaging	Het
Vwa5b1	T	C	4: 138,605,477	K258R	probably benign	Het
Xkr6	A	G	14: 63,818,925	Y95C	unknown	Het
Zfp180	T	C	7: 24,101,574		probably benign	Het
Zfp90	A	G	8: 106,424,095	T147A	probably benign	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174208390	nonsense	probably null
IGL01095:Spta1	APN	1	174213485	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174187263	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174203311	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174217159	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174208394	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174244180	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174174372	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174213862	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174203294	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174190231	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174217689	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174174463	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174218814	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174244110	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174211598	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174187288	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174181058	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174218743	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174213918	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174214144	missense	probably benign	0.08
Deflection	UTSW	1	174241087	missense	probably damaging	1.00
Goldfoil	UTSW	1	174218512	missense	probably damaging	1.00
H8786:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174207032	splice site	probably benign
R0172:Spta1	UTSW	1	174230786	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174217894	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174243179	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174218451	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174213942	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174224457	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174181104	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174174426	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174245205	unclassified	probably benign
R1131:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174211614	nonsense	probably null
R1184:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174222684	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174231325	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174247353	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174240166	missense	possibly damaging	0.94
R1566:Spta1	UTSW	1	174184706	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174213495	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174241042	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174245730	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174246549	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174195947	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174219839	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174240367	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174211647	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174244198	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174208344	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174212614	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174229258	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174192966	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174244114	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174174341	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174178656	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174208314	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174241137	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174174556	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174240357	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174179852	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174247424	nonsense	probably null
R4525:Spta1	UTSW	1	174207110	missense	probably null	1.00
R4614:Spta1	UTSW	1	174192977	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174191062	splice site	probably null
R4782:Spta1	UTSW	1	174230666	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174244042	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174237927	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174237834	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174217863	splice site	probably null
R4911:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174191056	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174246608	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174240223	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174247434	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174195985	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174215529	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174217193	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174175770	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174219902	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174214255	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174184797	splice site	probably null
R5845:Spta1	UTSW	1	174241096	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174223328	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174224520	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174181776	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174218512	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174241087	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174214177	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174211646	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174214168	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174203322	missense	probably benign
R6387:Spta1	UTSW	1	174231333	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174217201	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174187148	splice site	probably null
R6533:Spta1	UTSW	1	174244147	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174178685	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174244042	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174209325	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174209352	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174199484	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174174510	missense	probably benign
R7151:Spta1	UTSW	1	174197751	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174184612	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174223271	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174222637	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174223349	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174197635	nonsense	probably null
R7472:Spta1	UTSW	1	174246499	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174197783	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174205378	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174195981	nonsense	probably null
R7784:Spta1	UTSW	1	174202451	missense	probably damaging	1.00
R7804:Spta1	UTSW	1	174195905	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174218830	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174197785	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174174390	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174240171	missense	probably damaging	1.00
R8059:Spta1	UTSW	1	174218370	intron	probably benign
R8076:Spta1	UTSW	1	174187231	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174217944	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174202386	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174179821	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174247387	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174240211	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174215485	missense	probably benign	0.00
R8550:Spta1	UTSW	1	174187208	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174231360	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174209319	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174213444	missense	probably benign	0.42
RF020:Spta1	UTSW	1	174217903	missense	probably damaging	1.00
T0722:Spta1	UTSW	1	174191066	splice site	probably benign
X0028:Spta1	UTSW	1	174224450	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174191051	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174240367	missense	probably damaging	0.99
Z1177:Spta1	UTSW	1	174190162	missense	probably benign	0.09
Z1177:Spta1	UTSW	1	174245689	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACGTAatttatttttcattctgcccacagttt -3'
(R):5'- GTGTTAGCCTTTTCTTTGCCATGACC -3'

Sequencing Primer
(F):5'- gtgcttatagaggtcagaggg -3'
(R):5'- CTTTTCCCCAAAGAATGAAGTCAAGG -3'

Posted On

2014-04-13