Incidental Mutation 'R1555:U2surp'
ID170227
Institutional Source Beutler Lab
Gene Symbol U2surp
Ensembl Gene ENSMUSG00000032407
Gene NameU2 snRNP-associated SURP domain containing
Synonyms2610101N10Rik
MMRRC Submission 039594-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1555 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95456898-95511996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95466577 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 874 (V874A)
Ref Sequence ENSEMBL: ENSMUSP00000151121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078374] [ENSMUST00000079659] [ENSMUST00000191213] [ENSMUST00000217176]
Predicted Effect probably damaging
Transcript: ENSMUST00000078374
AA Change: V831A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077482
Gene: ENSMUSG00000032407
AA Change: V831A

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
coiled coil region 148 186 N/A INTRINSIC
RRM 231 307 1.85e-18 SMART
low complexity region 313 323 N/A INTRINSIC
SWAP 384 438 1.07e-20 SMART
RPR 493 632 1.42e-41 SMART
internal_repeat_1 648 665 6.09e-7 PROSPERO
internal_repeat_1 678 698 6.09e-7 PROSPERO
coiled coil region 742 769 N/A INTRINSIC
cwf21 792 843 6.31e-17 SMART
low complexity region 881 933 N/A INTRINSIC
low complexity region 939 985 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079659
AA Change: V875A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078602
Gene: ENSMUSG00000032407
AA Change: V875A

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 1.85e-18 SMART
low complexity region 357 367 N/A INTRINSIC
SWAP 428 482 1.07e-20 SMART
RPR 537 676 1.42e-41 SMART
internal_repeat_1 692 709 1.14e-6 PROSPERO
internal_repeat_1 722 742 1.14e-6 PROSPERO
coiled coil region 786 813 N/A INTRINSIC
cwf21 836 887 6.31e-17 SMART
low complexity region 925 977 N/A INTRINSIC
low complexity region 983 1029 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191213
SMART Domains Protein: ENSMUSP00000140614
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 7.8e-21 SMART
low complexity region 357 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217176
AA Change: V874A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1025 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,974,901 probably null Het
Adamts1 T A 16: 85,797,888 T358S probably benign Het
Ate1 A T 7: 130,509,091 F169I probably benign Het
Cdkl4 T A 17: 80,543,614 probably benign Het
Clcnkb T C 4: 141,411,739 probably null Het
Col6a4 C T 9: 106,000,886 R1964Q possibly damaging Het
Dcakd C T 11: 103,000,213 V17I probably damaging Het
Dcdc5 T G 2: 106,384,135 noncoding transcript Het
Erc2 T A 14: 28,011,665 D557E probably damaging Het
Grid2 A T 6: 64,429,684 D676V possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Igkv10-96 C T 6: 68,632,381 probably benign Het
Mier3 T A 13: 111,708,359 N248K probably damaging Het
Myo5b A T 18: 74,569,782 I15F probably damaging Het
Neurl3 A G 1: 36,266,532 V198A probably benign Het
Notch2 C A 3: 98,131,340 N1266K possibly damaging Het
Nup107 A G 10: 117,751,490 probably benign Het
Olfr214 A T 6: 116,556,826 I134F probably damaging Het
Olfr675 T C 7: 105,024,522 I153V probably benign Het
Phf3 G T 1: 30,805,877 H1334N possibly damaging Het
Phyhd1 T A 2: 30,274,706 I100N probably damaging Het
Rad21l T A 2: 151,658,428 T224S probably benign Het
Rxra C T 2: 27,748,678 A231V probably benign Het
Sac3d1 T C 19: 6,118,405 D61G probably damaging Het
Sbf1 A G 15: 89,305,076 Y481H probably damaging Het
Spg11 T C 2: 122,097,377 E642G probably damaging Het
Spta1 A G 1: 174,178,749 Y159C probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tedc1 G T 12: 113,156,497 probably benign Het
Tmem200a A T 10: 25,993,884 D162E probably damaging Het
Tmprss11e T A 5: 86,715,588 Q206L probably damaging Het
Tpra1 A G 6: 88,910,203 N175S probably damaging Het
Ttll10 T C 4: 156,035,139 E601G probably benign Het
Ttll6 G T 11: 96,145,582 D346Y probably damaging Het
Vwa5b1 T C 4: 138,605,477 K258R probably benign Het
Xkr6 A G 14: 63,818,925 Y95C unknown Het
Zfp180 T C 7: 24,101,574 probably benign Het
Zfp90 A G 8: 106,424,095 T147A probably benign Het
Other mutations in U2surp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:U2surp APN 9 95461524 utr 3 prime probably benign
IGL01122:U2surp APN 9 95490234 missense probably benign 0.02
IGL01985:U2surp APN 9 95490226 missense probably damaging 1.00
IGL01992:U2surp APN 9 95464419 missense possibly damaging 0.46
IGL01992:U2surp APN 9 95482181 missense probably damaging 0.99
IGL02300:U2surp APN 9 95488770 missense probably damaging 1.00
IGL02491:U2surp APN 9 95490220 missense probably damaging 0.98
IGL02503:U2surp APN 9 95502569 missense probably benign 0.03
IGL02615:U2surp APN 9 95493231 missense probably benign 0.00
IGL02628:U2surp APN 9 95472090 missense possibly damaging 0.89
IGL02682:U2surp APN 9 95481651 critical splice donor site probably null
IGL02721:U2surp APN 9 95474435 missense probably benign 0.10
IGL03200:U2surp APN 9 95491391 nonsense probably null
coup UTSW 9 95477512 missense probably damaging 1.00
R0095:U2surp UTSW 9 95500684 splice site probably null
R0373:U2surp UTSW 9 95484443 missense probably benign 0.08
R0376:U2surp UTSW 9 95484443 missense probably benign 0.08
R0377:U2surp UTSW 9 95484443 missense probably benign 0.08
R0416:U2surp UTSW 9 95485607 missense probably damaging 1.00
R0682:U2surp UTSW 9 95484443 missense probably benign 0.08
R0948:U2surp UTSW 9 95461497 utr 3 prime probably benign
R1420:U2surp UTSW 9 95462803 missense probably benign 0.33
R1474:U2surp UTSW 9 95493198 missense possibly damaging 0.49
R1597:U2surp UTSW 9 95481740 splice site probably benign
R1638:U2surp UTSW 9 95484227 missense possibly damaging 0.95
R1693:U2surp UTSW 9 95511860 start codon destroyed probably null 0.53
R1851:U2surp UTSW 9 95482097 nonsense probably null
R2271:U2surp UTSW 9 95491420 missense possibly damaging 0.80
R2679:U2surp UTSW 9 95476232 missense possibly damaging 0.82
R2851:U2surp UTSW 9 95500682 splice site probably null
R3769:U2surp UTSW 9 95493697 splice site probably benign
R4596:U2surp UTSW 9 95485628 missense probably damaging 1.00
R4672:U2surp UTSW 9 95493145 missense possibly damaging 0.83
R4763:U2surp UTSW 9 95511791 intron probably benign
R4995:U2surp UTSW 9 95462794 utr 3 prime probably benign
R5805:U2surp UTSW 9 95479304 missense possibly damaging 0.51
R6006:U2surp UTSW 9 95479307 missense probably damaging 0.96
R6249:U2surp UTSW 9 95500816 missense probably benign 0.07
R6260:U2surp UTSW 9 95476157 missense probably damaging 0.99
R6378:U2surp UTSW 9 95491421 missense probably benign 0.41
R6487:U2surp UTSW 9 95477512 missense probably damaging 1.00
R6585:U2surp UTSW 9 95472071 missense probably damaging 1.00
R6721:U2surp UTSW 9 95491104 missense probably damaging 0.99
R6760:U2surp UTSW 9 95493711 missense probably benign 0.27
R7065:U2surp UTSW 9 95485659 missense probably benign 0.01
R7167:U2surp UTSW 9 95481673 missense probably damaging 0.98
R7219:U2surp UTSW 9 95490162 nonsense probably null
R7232:U2surp UTSW 9 95493717 missense probably benign 0.03
R7460:U2surp UTSW 9 95462824 missense unknown
R7547:U2surp UTSW 9 95479349 missense possibly damaging 0.94
R7609:U2surp UTSW 9 95485679 splice site probably null
R7761:U2surp UTSW 9 95488761 missense probably damaging 1.00
R8520:U2surp UTSW 9 95502554 missense possibly damaging 0.88
X0018:U2surp UTSW 9 95475288 missense probably benign 0.14
X0018:U2surp UTSW 9 95485597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGAAGCCCAGAACTCTCCAATGTG -3'
(R):5'- GTATTCTCCTGGCTGCCTGAGAAC -3'

Sequencing Primer
(F):5'- GAACTCTCCAATGTGCGATG -3'
(R):5'- GGGCTTGTCTAACAGACTTTATATTG -3'
Posted On2014-04-13