Incidental Mutation 'R1556:Mdga2'
ID170291
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1556 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66550593 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 709 (Y709F)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037181
AA Change: Y709F

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: Y709F

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000178814
AA Change: Y699F
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: Y699F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222167
AA Change: Y640F

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000222623
Predicted Effect probably benign
Transcript: ENSMUST00000222987
Predicted Effect possibly damaging
Transcript: ENSMUST00000223141
AA Change: Y640F

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223289
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Cabyr A G 18: 12,744,780 D58G probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAACAAAGTCTGAAGAAGGGACTAC -3'
(R):5'- GCAAGACCATACCTCCAATCCTTAGTG -3'

Sequencing Primer
(F):5'- GTCTGAAGAAGGGACTACAATAAAAC -3'
(R):5'- aaccccctatcccatccc -3'
Posted On2014-04-13