Incidental Mutation 'R1556:Cabyr'
ID170313
Institutional Source Beutler Lab
Gene Symbol Cabyr
Ensembl Gene ENSMUSG00000024430
Gene Namecalcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2)
SynonymsFSP-2, 4933421A18Rik, CBP86, 1700016C01Rik
MMRRC Submission 039595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1556 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12741324-12755146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12744780 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 58 (D58G)
Ref Sequence ENSEMBL: ENSMUSP00000140894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000119108] [ENSMUST00000121018] [ENSMUST00000150758] [ENSMUST00000186263] [ENSMUST00000191078]
Predicted Effect probably damaging
Transcript: ENSMUST00000080415
AA Change: D58G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430
AA Change: D58G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115857
AA Change: D58G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430
AA Change: D58G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119108
AA Change: D58G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430
AA Change: D58G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121018
AA Change: D58G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430
AA Change: D58G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121453
Predicted Effect probably damaging
Transcript: ENSMUST00000150758
AA Change: D58G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430
AA Change: D58G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186263
AA Change: D58G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430
AA Change: D58G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191078
AA Change: D58G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430
AA Change: D58G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout affects sperm flagellum morphology, resulting in reduced sperm motility. These mutant males are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,449,633 S302P probably damaging Het
Anapc1 T C 2: 128,624,899 T1626A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arid5a T A 1: 36,320,164 Y520* probably null Het
Aven G A 2: 112,630,885 M215I probably damaging Het
Ccdc146 A G 5: 21,330,553 Y168H probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cd68 T A 11: 69,665,850 T44S probably damaging Het
Clstn2 A T 9: 97,456,505 I867N probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Col6a6 A G 9: 105,709,473 V1783A possibly damaging Het
Dach2 T C X: 113,298,517 S31P probably benign Het
Dpp8 T A 9: 65,051,479 W279R probably damaging Het
Fras1 A T 5: 96,743,062 I2817F possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gdf7 T C 12: 8,301,698 N79S unknown Het
Gpam A G 19: 55,076,331 V647A possibly damaging Het
Gpatch1 T C 7: 35,295,351 T497A probably benign Het
Grin2a A T 16: 9,707,715 F337L probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
H2-Aa A T 17: 34,284,416 V69D possibly damaging Het
H2-M10.5 T C 17: 36,773,313 Y56H probably damaging Het
Kcnu1 G A 8: 25,861,191 probably null Het
Krt77 A G 15: 101,861,278 S386P probably damaging Het
L3mbtl2 T A 15: 81,682,002 M342K probably benign Het
Ldlrad1 A G 4: 107,217,813 T186A probably benign Het
Lins1 C A 7: 66,710,637 C168* probably null Het
Lrrtm3 G A 10: 64,088,149 T413M probably damaging Het
Macf1 T C 4: 123,455,020 D4038G probably damaging Het
Mark3 T G 12: 111,627,841 N308K probably damaging Het
Mdga2 T A 12: 66,550,593 Y709F possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr59 T A 11: 74,288,936 C97S probably damaging Het
Olfr645 T A 7: 104,084,261 H273L probably benign Het
Olfr726 G A 14: 50,084,459 A74V possibly damaging Het
Olfr809 T C 10: 129,776,373 V168A probably benign Het
Ovgp1 A G 3: 105,986,752 probably benign Het
P4ha2 A G 11: 54,125,010 T408A probably damaging Het
Pcdh8 T G 14: 79,770,403 D240A probably damaging Het
Pcyt2 T C 11: 120,612,085 probably null Het
Pecr T A 1: 72,259,383 I293L probably benign Het
Pogk A G 1: 166,398,833 V583A possibly damaging Het
Prkg1 T C 19: 30,624,743 K371R probably benign Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rgs12 A G 5: 35,039,282 R769G possibly damaging Het
Sgtb T A 13: 104,139,776 N237K probably damaging Het
Sh3bgrl2 T C 9: 83,594,698 V91A probably damaging Het
Slc4a1ap G A 5: 31,534,210 probably null Het
Slc4a7 T C 14: 14,778,872 V940A probably benign Het
Tep1 T C 14: 50,853,042 T740A probably benign Het
Tnk2 G T 16: 32,670,919 probably null Het
Trpv2 A G 11: 62,592,233 Y450C probably damaging Het
Tvp23a A T 16: 10,446,998 D16E probably damaging Het
Twnk T C 19: 45,009,411 F460L possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Urb2 T C 8: 124,030,617 L1021P probably damaging Het
Vps13c T C 9: 67,930,711 Y1848H probably damaging Het
Vwa8 T G 14: 79,086,681 N1141K probably benign Het
Yipf3 A G 17: 46,250,867 Y200C probably damaging Het
Zbtb38 A G 9: 96,686,991 V680A probably benign Het
Zcchc6 T C 13: 59,800,240 T354A probably benign Het
Znrf3 T C 11: 5,281,347 E722G probably benign Het
Zzef1 T A 11: 72,915,233 L2665H probably damaging Het
Other mutations in Cabyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Cabyr APN 18 12744610 missense probably damaging 0.99
R0547:Cabyr UTSW 18 12751016 missense probably benign 0.07
R0571:Cabyr UTSW 18 12750852 missense probably damaging 1.00
R3084:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3085:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3086:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3824:Cabyr UTSW 18 12751690 missense probably benign 0.04
R3898:Cabyr UTSW 18 12751523 missense probably benign 0.00
R4869:Cabyr UTSW 18 12751818 makesense probably null
R4933:Cabyr UTSW 18 12744492 splice site probably benign
R5036:Cabyr UTSW 18 12751246 missense probably damaging 1.00
R5482:Cabyr UTSW 18 12751439 missense possibly damaging 0.95
R5932:Cabyr UTSW 18 12754350 missense probably damaging 1.00
R6515:Cabyr UTSW 18 12754283 missense possibly damaging 0.93
R6556:Cabyr UTSW 18 12751016 missense probably benign 0.07
R6852:Cabyr UTSW 18 12754097 missense probably benign 0.35
R6907:Cabyr UTSW 18 12750912 missense probably benign 0.05
R7193:Cabyr UTSW 18 12751758 missense probably damaging 1.00
R7565:Cabyr UTSW 18 12744599 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCAAAGCCCAGACTTGTTGTACCC -3'
(R):5'- GCAAAGCACAGAACGGTCATTTCAC -3'

Sequencing Primer
(F):5'- GGAGTTAGCAGAGCCATTCTC -3'
(R):5'- GGTCATTTCACATGAGACACTG -3'
Posted On2014-04-13