Incidental Mutation 'R1557:Dnah6'
ID 170340
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
MMRRC Submission 039596-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R1557 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 73017606-73221651 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 73049131 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 3460 (Q3460*)
Ref Sequence ENSEMBL: ENSMUSP00000144791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000064948
AA Change: Q3460*
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: Q3460*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114040
AA Change: Q3408*
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: Q3408*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204053
AA Change: Q3460*
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: Q3460*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A C 1: 53,181,866 D68E possibly damaging Het
Abca3 T C 17: 24,399,980 V870A possibly damaging Het
Aldh3a2 A T 11: 61,249,059 F416I probably damaging Het
Armc6 A T 8: 70,225,448 L77Q possibly damaging Het
Asb17 A G 3: 153,850,933 I226V probably benign Het
Aspm A G 1: 139,468,668 I862V probably benign Het
Atr T A 9: 95,871,449 D701E probably damaging Het
Baz1b C T 5: 135,218,243 L849F possibly damaging Het
Cbr1 T C 16: 93,608,789 V97A probably benign Het
Cep295 G A 9: 15,332,010 Q1669* probably null Het
Cfap54 T C 10: 92,984,227 T1242A possibly damaging Het
Chrm3 T A 13: 9,878,314 T229S possibly damaging Het
Cnga3 A G 1: 37,260,985 Y300C probably damaging Het
Col14a1 A C 15: 55,388,579 I544L unknown Het
Crocc T C 4: 141,025,465 E1208G probably damaging Het
Cyp2j8 A T 4: 96,470,476 probably benign Het
Dcbld2 T C 16: 58,465,350 I624T possibly damaging Het
Ddah1 A C 3: 145,891,472 I258L probably benign Het
Dync2h1 T A 9: 7,140,911 D1372V probably damaging Het
Egln1 G A 8: 124,948,241 R272* probably null Het
Elf1 A G 14: 79,567,180 D95G possibly damaging Het
Fkbp5 A G 17: 28,402,755 F374L probably damaging Het
Fli1 T C 9: 32,461,244 probably benign Het
Gabbr2 T C 4: 46,846,436 T158A probably damaging Het
Gp2 A C 7: 119,450,079 Y412D probably damaging Het
Hmcn1 A G 1: 150,734,532 V1462A possibly damaging Het
Ide T C 19: 37,280,761 probably null Het
Kalrn T C 16: 34,314,278 K372R possibly damaging Het
Kcnj16 A G 11: 111,025,241 D243G possibly damaging Het
Kif7 A G 7: 79,714,157 M1T probably null Het
Klri2 A T 6: 129,732,211 L226Q probably damaging Het
Kremen1 T C 11: 5,215,373 probably null Het
Lama3 T C 18: 12,513,731 probably benign Het
Lmln C A 16: 33,088,211 R336S probably benign Het
Lrch4 T A 5: 137,637,556 D266E probably benign Het
Lrrc28 C T 7: 67,559,929 R174H probably damaging Het
Mib1 T A 18: 10,798,474 D778E probably damaging Het
Msra T C 14: 64,123,326 I125V possibly damaging Het
Olfr1180 A T 2: 88,412,211 V149E possibly damaging Het
Olfr1281 T A 2: 111,328,619 S67T probably damaging Het
Olfr670 A G 7: 104,960,540 F64S probably damaging Het
Olfr790 C A 10: 129,501,622 T246N probably damaging Het
Olfr930 A G 9: 38,930,659 M163V possibly damaging Het
Olfr95 A G 17: 37,211,353 F167L probably damaging Het
Pes1 T A 11: 3,976,824 Y369N probably damaging Het
Pgam2 T C 11: 5,801,773 D221G possibly damaging Het
Prl2c5 T C 13: 13,190,680 V137A possibly damaging Het
Rasal1 T A 5: 120,676,849 D721E possibly damaging Het
Sass6 G T 3: 116,618,732 E385D possibly damaging Het
Sema5a A G 15: 32,460,272 R60G probably benign Het
Sesn1 T C 10: 41,903,766 S399P probably damaging Het
Skiv2l G A 17: 34,848,422 L47F probably damaging Het
Slc10a2 C T 8: 5,091,755 V210M probably damaging Het
Slc8a3 C T 12: 81,315,557 G163S probably damaging Het
Sorbs2 T C 8: 45,759,197 probably benign Het
Speer4f1 T C 5: 17,479,492 W173R probably damaging Het
Spon2 C A 5: 33,216,764 G92W probably damaging Het
Sycp2 A T 2: 178,395,216 probably benign Het
Tex33 C A 15: 78,386,274 R98M probably damaging Het
Tfb1m A G 17: 3,554,966 V84A probably damaging Het
Tmem18 G T 12: 30,587,199 probably null Het
Tom1l1 A G 11: 90,656,384 L290S possibly damaging Het
Tube1 T G 10: 39,145,715 probably null Het
Ugt2b35 T A 5: 87,007,297 probably null Het
Unc93b1 T A 19: 3,942,403 Y269N probably benign Het
Usp16 T C 16: 87,462,142 probably null Het
Vmn1r38 A T 6: 66,776,386 S249T probably benign Het
Vmn1r42 T A 6: 89,844,751 M279L possibly damaging Het
Zdhhc23 T A 16: 43,971,466 T315S possibly damaging Het
Zfp472 T C 17: 32,975,926 F12L probably benign Het
Zfr2 T C 10: 81,247,391 S634P probably benign Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 splice site probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 splice site probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7203:Dnah6 UTSW 6 73173545 missense probably benign 0.00
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7387:Dnah6 UTSW 6 73212612 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73169080 splice site probably null
R7735:Dnah6 UTSW 6 73069429 missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73025720 missense probably benign 0.41
R7829:Dnah6 UTSW 6 73127919 nonsense probably null
R7904:Dnah6 UTSW 6 73135467 splice site probably null
R8034:Dnah6 UTSW 6 73129225 missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73160913 missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73025786 missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73060225 missense probably benign 0.16
R8206:Dnah6 UTSW 6 73037566 nonsense probably null
R8214:Dnah6 UTSW 6 73044728 missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73168827 critical splice donor site probably null
R8273:Dnah6 UTSW 6 73076599 missense probably benign 0.31
R8273:Dnah6 UTSW 6 73195681 missense probably benign 0.00
R8331:Dnah6 UTSW 6 73025000 missense probably benign 0.10
R8350:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8428:Dnah6 UTSW 6 73074651 missense probably benign 0.15
R8447:Dnah6 UTSW 6 73138774 missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8517:Dnah6 UTSW 6 73178457 missense probably benign 0.16
R8523:Dnah6 UTSW 6 73095188 missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73168867 missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73075890 intron probably benign
R8737:Dnah6 UTSW 6 73067445 missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73179828 missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73065773 missense probably benign
R8809:Dnah6 UTSW 6 73032563 missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73127954 missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73144173 critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 73021148 missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73178498 missense probably benign 0.05
R8973:Dnah6 UTSW 6 73144751 missense probably benign 0.39
R9049:Dnah6 UTSW 6 73142292 missense probably damaging 1.00
R9053:Dnah6 UTSW 6 73084657 missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73149173 missense probably benign 0.00
R9077:Dnah6 UTSW 6 73144046 nonsense probably null
R9102:Dnah6 UTSW 6 73067486 missense probably benign
R9106:Dnah6 UTSW 6 73144769 missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73060203 missense possibly damaging 0.95
R9124:Dnah6 UTSW 6 73121899 missense possibly damaging 0.78
R9165:Dnah6 UTSW 6 73144941 missense probably damaging 1.00
R9182:Dnah6 UTSW 6 73144705 nonsense probably null
R9200:Dnah6 UTSW 6 73027514 missense probably benign 0.06
R9265:Dnah6 UTSW 6 73083057 missense probably benign 0.02
R9368:Dnah6 UTSW 6 73021278 missense probably benign 0.22
R9378:Dnah6 UTSW 6 73212530 missense probably benign
R9439:Dnah6 UTSW 6 73035347 missense possibly damaging 0.66
R9506:Dnah6 UTSW 6 73142316 missense probably damaging 1.00
R9645:Dnah6 UTSW 6 73138767 missense possibly damaging 0.82
R9731:Dnah6 UTSW 6 73191606 missense probably benign 0.00
RF002:Dnah6 UTSW 6 73101889 missense probably benign
RF020:Dnah6 UTSW 6 73118057 missense probably benign 0.00
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Z1176:Dnah6 UTSW 6 73087783 missense possibly damaging 0.79
Z1176:Dnah6 UTSW 6 73133559 missense probably benign
Z1177:Dnah6 UTSW 6 73021237 missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73032526 missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 73041138 missense probably damaging 1.00
Z1177:Dnah6 UTSW 6 73155272 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGAGGGAAAACACATTCTCTAAAGCCA -3'
(R):5'- ACCCAGGGTTACCCTAATCATTTCCA -3'

Sequencing Primer
(F):5'- AAACCTGACTCTTGTTAGATCCAC -3'
(R):5'- accctaatcatttccaatttccttc -3'
Posted On 2014-04-13