Mutagenetix > Incidental Mutation

Incidental Mutation 'R1557:Slc8a3'

170366

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

039596-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1557 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81315557 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 163 (G163S)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

probably damaging
Transcript: ENSMUST00000064594
AA Change: G163S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: G163S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: G163S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: G163S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: G163S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: G163S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Meta Mutation Damage Score

0.6556

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	C	1: 53,181,866	D68E	possibly damaging	Het
Abca3	T	C	17: 24,399,980	V870A	possibly damaging	Het
Aldh3a2	A	T	11: 61,249,059	F416I	probably damaging	Het
Armc6	A	T	8: 70,225,448	L77Q	possibly damaging	Het
Asb17	A	G	3: 153,850,933	I226V	probably benign	Het
Aspm	A	G	1: 139,468,668	I862V	probably benign	Het
Atr	T	A	9: 95,871,449	D701E	probably damaging	Het
Baz1b	C	T	5: 135,218,243	L849F	possibly damaging	Het
Cbr1	T	C	16: 93,608,789	V97A	probably benign	Het
Cep295	G	A	9: 15,332,010	Q1669*	probably null	Het
Cfap54	T	C	10: 92,984,227	T1242A	possibly damaging	Het
Chrm3	T	A	13: 9,878,314	T229S	possibly damaging	Het
Cnga3	A	G	1: 37,260,985	Y300C	probably damaging	Het
Col14a1	A	C	15: 55,388,579	I544L	unknown	Het
Crocc	T	C	4: 141,025,465	E1208G	probably damaging	Het
Cyp2j8	A	T	4: 96,470,476		probably benign	Het
Dcbld2	T	C	16: 58,465,350	I624T	possibly damaging	Het
Ddah1	A	C	3: 145,891,472	I258L	probably benign	Het
Dnah6	G	A	6: 73,049,131	Q3460*	probably null	Het
Dync2h1	T	A	9: 7,140,911	D1372V	probably damaging	Het
Egln1	G	A	8: 124,948,241	R272*	probably null	Het
Elf1	A	G	14: 79,567,180	D95G	possibly damaging	Het
Fkbp5	A	G	17: 28,402,755	F374L	probably damaging	Het
Fli1	T	C	9: 32,461,244		probably benign	Het
Gabbr2	T	C	4: 46,846,436	T158A	probably damaging	Het
Gp2	A	C	7: 119,450,079	Y412D	probably damaging	Het
Hmcn1	A	G	1: 150,734,532	V1462A	possibly damaging	Het
Ide	T	C	19: 37,280,761		probably null	Het
Kalrn	T	C	16: 34,314,278	K372R	possibly damaging	Het
Kcnj16	A	G	11: 111,025,241	D243G	possibly damaging	Het
Kif7	A	G	7: 79,714,157	M1T	probably null	Het
Klri2	A	T	6: 129,732,211	L226Q	probably damaging	Het
Kremen1	T	C	11: 5,215,373		probably null	Het
Lama3	T	C	18: 12,513,731		probably benign	Het
Lmln	C	A	16: 33,088,211	R336S	probably benign	Het
Lrch4	T	A	5: 137,637,556	D266E	probably benign	Het
Lrrc28	C	T	7: 67,559,929	R174H	probably damaging	Het
Mib1	T	A	18: 10,798,474	D778E	probably damaging	Het
Msra	T	C	14: 64,123,326	I125V	possibly damaging	Het
Olfr1180	A	T	2: 88,412,211	V149E	possibly damaging	Het
Olfr1281	T	A	2: 111,328,619	S67T	probably damaging	Het
Olfr670	A	G	7: 104,960,540	F64S	probably damaging	Het
Olfr790	C	A	10: 129,501,622	T246N	probably damaging	Het
Olfr930	A	G	9: 38,930,659	M163V	possibly damaging	Het
Olfr95	A	G	17: 37,211,353	F167L	probably damaging	Het
Pes1	T	A	11: 3,976,824	Y369N	probably damaging	Het
Pgam2	T	C	11: 5,801,773	D221G	possibly damaging	Het
Prl2c5	T	C	13: 13,190,680	V137A	possibly damaging	Het
Rasal1	T	A	5: 120,676,849	D721E	possibly damaging	Het
Sass6	G	T	3: 116,618,732	E385D	possibly damaging	Het
Sema5a	A	G	15: 32,460,272	R60G	probably benign	Het
Sesn1	T	C	10: 41,903,766	S399P	probably damaging	Het
Skiv2l	G	A	17: 34,848,422	L47F	probably damaging	Het
Slc10a2	C	T	8: 5,091,755	V210M	probably damaging	Het
Sorbs2	T	C	8: 45,759,197		probably benign	Het
Speer4f1	T	C	5: 17,479,492	W173R	probably damaging	Het
Spon2	C	A	5: 33,216,764	G92W	probably damaging	Het
Sycp2	A	T	2: 178,395,216		probably benign	Het
Tex33	C	A	15: 78,386,274	R98M	probably damaging	Het
Tfb1m	A	G	17: 3,554,966	V84A	probably damaging	Het
Tmem18	G	T	12: 30,587,199		probably null	Het
Tom1l1	A	G	11: 90,656,384	L290S	possibly damaging	Het
Tube1	T	G	10: 39,145,715		probably null	Het
Ugt2b35	T	A	5: 87,007,297		probably null	Het
Unc93b1	T	A	19: 3,942,403	Y269N	probably benign	Het
Usp16	T	C	16: 87,462,142		probably null	Het
Vmn1r38	A	T	6: 66,776,386	S249T	probably benign	Het
Vmn1r42	T	A	6: 89,844,751	M279L	possibly damaging	Het
Zdhhc23	T	A	16: 43,971,466	T315S	possibly damaging	Het
Zfp472	T	C	17: 32,975,926	F12L	probably benign	Het
Zfr2	T	C	10: 81,247,391	S634P	probably benign	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- AAGAGCAGTCGCTTATCTGCCACC -3'
(R):5'- GTGACCATCAAGAAGCCCAATGGAG -3'

Sequencing Primer
(F):5'- GACTGCCAGGATCATATAGAGCC -3'
(R):5'- GCCCAATGGAGAGACCAGC -3'

Posted On

2014-04-13