Mutagenetix > Incidental Mutation

Incidental Mutation 'R1557:Lama3'

170387

Institutional Source

Beutler Lab

Gene Symbol

Lama3

Ensembl Gene

ENSMUSG00000024421

Gene Name

laminin, alpha 3

Synonyms

[a]3B, nicein, 150kDa

MMRRC Submission

039596-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1557 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12333819-12583013 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 12513731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000092070

SMART Domains

Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
LamNT	38	294	1.46e-153	SMART
EGF_Lam	296	350	1.39e-4	SMART
EGF_Lam	353	420	2.66e-10	SMART
EGF_Lam	423	464	3.51e-10	SMART
EGF_Lam	488	530	1.73e-9	SMART
EGF_Lam	533	576	3.81e-11	SMART
EGF_like	579	625	1.82e-1	SMART
EGF_Lam	628	678	5.15e-8	SMART
EGF_Lam	681	725	3.54e-6	SMART
low complexity region	768	781	N/A	INTRINSIC
EGF_Lam	1263	1306	3.15e-12	SMART
EGF_Lam	1309	1350	6.3e-3	SMART
EGF_Lam	1353	1399	1.49e-13	SMART
EGF_Lam	1402	1450	8.18e-11	SMART
LamB	1509	1638	4.34e-55	SMART
Pfam:Laminin_EGF	1647	1681	7.9e-5	PFAM
EGF_Lam	1684	1728	2.66e-10	SMART
EGF_Lam	1731	1781	7.81e-8	SMART
Pfam:Laminin_I	1836	2102	2.7e-93	PFAM
low complexity region	2185	2200	N/A	INTRINSIC
coiled coil region	2211	2238	N/A	INTRINSIC
LamG	2406	2566	1.67e-2	SMART
LamG	2614	2742	1.72e-17	SMART
LamG	2785	2900	3.96e-17	SMART
LamG	3005	3133	1.12e-34	SMART
LamG	3175	3308	3.41e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188815

SMART Domains

Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_Lam	78	122	2.66e-10	SMART
EGF_Lam	125	175	7.81e-8	SMART
Pfam:Laminin_I	230	496	1e-90	PFAM
low complexity region	579	594	N/A	INTRINSIC
coiled coil region	605	632	N/A	INTRINSIC
LamG	800	960	1.67e-2	SMART
LamG	1008	1136	1.72e-17	SMART
LamG	1179	1294	3.96e-17	SMART
LamG	1399	1527	1.12e-34	SMART
LamG	1569	1702	3.41e-30	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	C	1: 53,181,866	D68E	possibly damaging	Het
Abca3	T	C	17: 24,399,980	V870A	possibly damaging	Het
Aldh3a2	A	T	11: 61,249,059	F416I	probably damaging	Het
Armc6	A	T	8: 70,225,448	L77Q	possibly damaging	Het
Asb17	A	G	3: 153,850,933	I226V	probably benign	Het
Aspm	A	G	1: 139,468,668	I862V	probably benign	Het
Atr	T	A	9: 95,871,449	D701E	probably damaging	Het
Baz1b	C	T	5: 135,218,243	L849F	possibly damaging	Het
Cbr1	T	C	16: 93,608,789	V97A	probably benign	Het
Cep295	G	A	9: 15,332,010	Q1669*	probably null	Het
Cfap54	T	C	10: 92,984,227	T1242A	possibly damaging	Het
Chrm3	T	A	13: 9,878,314	T229S	possibly damaging	Het
Cnga3	A	G	1: 37,260,985	Y300C	probably damaging	Het
Col14a1	A	C	15: 55,388,579	I544L	unknown	Het
Crocc	T	C	4: 141,025,465	E1208G	probably damaging	Het
Cyp2j8	A	T	4: 96,470,476		probably benign	Het
Dcbld2	T	C	16: 58,465,350	I624T	possibly damaging	Het
Ddah1	A	C	3: 145,891,472	I258L	probably benign	Het
Dnah6	G	A	6: 73,049,131	Q3460*	probably null	Het
Dync2h1	T	A	9: 7,140,911	D1372V	probably damaging	Het
Egln1	G	A	8: 124,948,241	R272*	probably null	Het
Elf1	A	G	14: 79,567,180	D95G	possibly damaging	Het
Fkbp5	A	G	17: 28,402,755	F374L	probably damaging	Het
Fli1	T	C	9: 32,461,244		probably benign	Het
Gabbr2	T	C	4: 46,846,436	T158A	probably damaging	Het
Gp2	A	C	7: 119,450,079	Y412D	probably damaging	Het
Hmcn1	A	G	1: 150,734,532	V1462A	possibly damaging	Het
Ide	T	C	19: 37,280,761		probably null	Het
Kalrn	T	C	16: 34,314,278	K372R	possibly damaging	Het
Kcnj16	A	G	11: 111,025,241	D243G	possibly damaging	Het
Kif7	A	G	7: 79,714,157	M1T	probably null	Het
Klri2	A	T	6: 129,732,211	L226Q	probably damaging	Het
Kremen1	T	C	11: 5,215,373		probably null	Het
Lmln	C	A	16: 33,088,211	R336S	probably benign	Het
Lrch4	T	A	5: 137,637,556	D266E	probably benign	Het
Lrrc28	C	T	7: 67,559,929	R174H	probably damaging	Het
Mib1	T	A	18: 10,798,474	D778E	probably damaging	Het
Msra	T	C	14: 64,123,326	I125V	possibly damaging	Het
Olfr1180	A	T	2: 88,412,211	V149E	possibly damaging	Het
Olfr1281	T	A	2: 111,328,619	S67T	probably damaging	Het
Olfr670	A	G	7: 104,960,540	F64S	probably damaging	Het
Olfr790	C	A	10: 129,501,622	T246N	probably damaging	Het
Olfr930	A	G	9: 38,930,659	M163V	possibly damaging	Het
Olfr95	A	G	17: 37,211,353	F167L	probably damaging	Het
Pes1	T	A	11: 3,976,824	Y369N	probably damaging	Het
Pgam2	T	C	11: 5,801,773	D221G	possibly damaging	Het
Prl2c5	T	C	13: 13,190,680	V137A	possibly damaging	Het
Rasal1	T	A	5: 120,676,849	D721E	possibly damaging	Het
Sass6	G	T	3: 116,618,732	E385D	possibly damaging	Het
Sema5a	A	G	15: 32,460,272	R60G	probably benign	Het
Sesn1	T	C	10: 41,903,766	S399P	probably damaging	Het
Skiv2l	G	A	17: 34,848,422	L47F	probably damaging	Het
Slc10a2	C	T	8: 5,091,755	V210M	probably damaging	Het
Slc8a3	C	T	12: 81,315,557	G163S	probably damaging	Het
Sorbs2	T	C	8: 45,759,197		probably benign	Het
Speer4f1	T	C	5: 17,479,492	W173R	probably damaging	Het
Spon2	C	A	5: 33,216,764	G92W	probably damaging	Het
Sycp2	A	T	2: 178,395,216		probably benign	Het
Tex33	C	A	15: 78,386,274	R98M	probably damaging	Het
Tfb1m	A	G	17: 3,554,966	V84A	probably damaging	Het
Tmem18	G	T	12: 30,587,199		probably null	Het
Tom1l1	A	G	11: 90,656,384	L290S	possibly damaging	Het
Tube1	T	G	10: 39,145,715		probably null	Het
Ugt2b35	T	A	5: 87,007,297		probably null	Het
Unc93b1	T	A	19: 3,942,403	Y269N	probably benign	Het
Usp16	T	C	16: 87,462,142		probably null	Het
Vmn1r38	A	T	6: 66,776,386	S249T	probably benign	Het
Vmn1r42	T	A	6: 89,844,751	M279L	possibly damaging	Het
Zdhhc23	T	A	16: 43,971,466	T315S	possibly damaging	Het
Zfp472	T	C	17: 32,975,926	F12L	probably benign	Het
Zfr2	T	C	10: 81,247,391	S634P	probably benign	Het

Other mutations in Lama3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Lama3	APN	18	12580292	missense	probably benign
IGL00272:Lama3	APN	18	12491548	missense	probably damaging	1.00
IGL00335:Lama3	APN	18	12449588	splice site	probably benign
IGL00836:Lama3	APN	18	12472228	missense	probably benign	0.01
IGL01017:Lama3	APN	18	12441143	critical splice donor site	probably null
IGL01025:Lama3	APN	18	12481037	missense	probably benign	0.09
IGL01394:Lama3	APN	18	12531926	missense	probably null	0.39
IGL01545:Lama3	APN	18	12441131	missense	probably benign	0.01
IGL01685:Lama3	APN	18	12453880	splice site	probably benign
IGL01863:Lama3	APN	18	12419936	splice site	probably benign
IGL01869:Lama3	APN	18	12524763	missense	possibly damaging	0.94
IGL01894:Lama3	APN	18	12572064	missense	probably benign	0.09
IGL02027:Lama3	APN	18	12516513	missense	probably damaging	1.00
IGL02106:Lama3	APN	18	12468314	missense	probably damaging	0.98
IGL02307:Lama3	APN	18	12581783	missense	probably benign	0.09
IGL02342:Lama3	APN	18	12491476	missense	probably damaging	1.00
IGL02377:Lama3	APN	18	12556750	missense	possibly damaging	0.49
IGL02401:Lama3	APN	18	12557727	missense	probably benign	0.02
IGL02517:Lama3	APN	18	12537858	critical splice donor site	probably null
IGL02644:Lama3	APN	18	12525853	missense	probably benign	0.12
IGL02733:Lama3	APN	18	12578127	missense	probably damaging	0.99
IGL02932:Lama3	APN	18	12528801	missense	probably damaging	1.00
IGL03006:Lama3	APN	18	12468368	splice site	probably benign
IGL03038:Lama3	APN	18	12419250	missense	probably damaging	0.99
IGL03064:Lama3	APN	18	12439349	missense	possibly damaging	0.72
IGL03146:Lama3	APN	18	12527624	missense	possibly damaging	0.66
IGL03233:Lama3	APN	18	12481038	missense	probably damaging	1.00
IGL03255:Lama3	APN	18	12539703	missense	probably damaging	1.00
IGL03369:Lama3	APN	18	12553283	missense	probably benign	0.05
IGL03412:Lama3	APN	18	12419182	missense	probably damaging	0.99
IGL02980:Lama3	UTSW	18	12553231	missense	probably benign	0.01
IGL03014:Lama3	UTSW	18	12539967	missense	possibly damaging	0.95
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0106:Lama3	UTSW	18	12403982	missense	probably damaging	0.96
R0148:Lama3	UTSW	18	12448272	missense	probably damaging	1.00
R0165:Lama3	UTSW	18	12524810	missense	probably damaging	0.99
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0316:Lama3	UTSW	18	12519877	missense	probably benign	0.09
R0325:Lama3	UTSW	18	12482126	missense	probably damaging	1.00
R0365:Lama3	UTSW	18	12507007	missense	probably damaging	0.96
R0390:Lama3	UTSW	18	12407563	missense	probably benign	0.10
R0408:Lama3	UTSW	18	12456837	missense	probably benign
R0449:Lama3	UTSW	18	12500512	splice site	probably null
R0453:Lama3	UTSW	18	12465478	missense	possibly damaging	0.63
R0480:Lama3	UTSW	18	12450424	missense	possibly damaging	0.81
R0536:Lama3	UTSW	18	12525894	missense	probably damaging	1.00
R0545:Lama3	UTSW	18	12561701	missense	possibly damaging	0.90
R0567:Lama3	UTSW	18	12549252	missense	probably benign
R0605:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R0617:Lama3	UTSW	18	12419258	critical splice donor site	probably null
R0629:Lama3	UTSW	18	12419245	missense	possibly damaging	0.79
R0671:Lama3	UTSW	18	12477590	missense	possibly damaging	0.80
R0730:Lama3	UTSW	18	12456850	splice site	probably benign
R1216:Lama3	UTSW	18	12421134	splice site	probably benign
R1356:Lama3	UTSW	18	12500577	unclassified	probably benign
R1386:Lama3	UTSW	18	12477370	missense	probably benign	0.04
R1424:Lama3	UTSW	18	12519991	missense	probably benign	0.13
R1426:Lama3	UTSW	18	12481098	critical splice donor site	probably null
R1437:Lama3	UTSW	18	12549227	missense	possibly damaging	0.46
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1472:Lama3	UTSW	18	12482045	missense	probably benign	0.23
R1571:Lama3	UTSW	18	12539717	missense	probably damaging	0.98
R1599:Lama3	UTSW	18	12450400	nonsense	probably null
R1631:Lama3	UTSW	18	12407494	missense	probably damaging	1.00
R1647:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1648:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1719:Lama3	UTSW	18	12479872	critical splice donor site	probably null
R1757:Lama3	UTSW	18	12465499	missense	probably benign	0.10
R1766:Lama3	UTSW	18	12402062	missense	probably damaging	1.00
R1853:Lama3	UTSW	18	12513705	missense	possibly damaging	0.75
R1856:Lama3	UTSW	18	12537781	nonsense	probably null
R1909:Lama3	UTSW	18	12581798	missense	probably benign	0.19
R1913:Lama3	UTSW	18	12495279	missense	probably benign	0.15
R1975:Lama3	UTSW	18	12453863	missense	probably damaging	1.00
R2014:Lama3	UTSW	18	12524721	splice site	probably benign
R2059:Lama3	UTSW	18	12528333	missense	probably damaging	0.98
R2060:Lama3	UTSW	18	12528726	missense	probably benign	0.30
R2086:Lama3	UTSW	18	12524830	missense	probably benign	0.39
R2115:Lama3	UTSW	18	12402849	missense	possibly damaging	0.94
R2291:Lama3	UTSW	18	12525079	missense	probably damaging	0.98
R2860:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2861:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2862:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R3410:Lama3	UTSW	18	12413858	critical splice donor site	probably null
R3614:Lama3	UTSW	18	12448288	missense	probably benign	0.03
R3696:Lama3	UTSW	18	12439475	splice site	probably benign
R3752:Lama3	UTSW	18	12507029	missense	probably damaging	1.00
R3967:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3968:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3969:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3970:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R4088:Lama3	UTSW	18	12504308	nonsense	probably null
R4118:Lama3	UTSW	18	12450431	missense	probably benign	0.01
R4222:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4223:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4224:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4225:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4367:Lama3	UTSW	18	12513690	missense	probably damaging	1.00
R4404:Lama3	UTSW	18	12582531	missense	probably benign	0.01
R4424:Lama3	UTSW	18	12519872	nonsense	probably null
R4483:Lama3	UTSW	18	12549253	missense	probably benign	0.32
R4484:Lama3	UTSW	18	12481088	missense	probably benign
R4516:Lama3	UTSW	18	12495358	missense	probably damaging	1.00
R4556:Lama3	UTSW	18	12479759	missense	possibly damaging	0.63
R4616:Lama3	UTSW	18	12504397	critical splice donor site	probably null
R4702:Lama3	UTSW	18	12578029	nonsense	probably null
R4704:Lama3	UTSW	18	12553223	missense	probably benign	0.08
R4750:Lama3	UTSW	18	12504359	missense	probably benign	0.25
R4753:Lama3	UTSW	18	12482084	missense	probably damaging	1.00
R4767:Lama3	UTSW	18	12500563	missense	probably benign	0.32
R4777:Lama3	UTSW	18	12413771	missense	probably damaging	1.00
R4782:Lama3	UTSW	18	12411570	nonsense	probably null
R4784:Lama3	UTSW	18	12449544	missense	probably benign	0.20
R4816:Lama3	UTSW	18	12477604	missense	possibly damaging	0.93
R4833:Lama3	UTSW	18	12441131	missense	probably benign	0.01
R4854:Lama3	UTSW	18	12411542	missense	probably benign	0.00
R4863:Lama3	UTSW	18	12498678	intron	probably benign
R4863:Lama3	UTSW	18	12539793	missense	probably damaging	0.99
R4953:Lama3	UTSW	18	12448305	missense	probably damaging	1.00
R4974:Lama3	UTSW	18	12552826	missense	probably damaging	0.98
R4996:Lama3	UTSW	18	12518743	missense	probably benign	0.24
R5049:Lama3	UTSW	18	12582611	missense	probably benign	0.19
R5057:Lama3	UTSW	18	12531948	missense	probably null	0.82
R5090:Lama3	UTSW	18	12542402	missense	possibly damaging	0.94
R5122:Lama3	UTSW	18	12539766	missense	possibly damaging	0.53
R5215:Lama3	UTSW	18	12577900	missense	probably damaging	1.00
R5245:Lama3	UTSW	18	12419893	missense	probably damaging	1.00
R5259:Lama3	UTSW	18	12465508	missense	probably damaging	1.00
R5320:Lama3	UTSW	18	12552855	missense	probably damaging	0.99
R5377:Lama3	UTSW	18	12453746	missense	probably damaging	0.99
R5432:Lama3	UTSW	18	12572066	missense	probably damaging	1.00
R5500:Lama3	UTSW	18	12456764	missense	possibly damaging	0.93
R5534:Lama3	UTSW	18	12553210	missense	probably benign	0.00
R5589:Lama3	UTSW	18	12472220	missense	possibly damaging	0.46
R5604:Lama3	UTSW	18	12439348	missense	probably benign
R5617:Lama3	UTSW	18	12498936	intron	probably benign
R5709:Lama3	UTSW	18	12539799	missense	probably damaging	1.00
R5965:Lama3	UTSW	18	12429887	missense	possibly damaging	0.67
R6042:Lama3	UTSW	18	12574254	missense	probably damaging	1.00
R6065:Lama3	UTSW	18	12469928	missense	possibly damaging	0.53
R6085:Lama3	UTSW	18	12482099	missense	probably benign	0.01
R6212:Lama3	UTSW	18	12513645	missense	probably damaging	1.00
R6268:Lama3	UTSW	18	12524737	missense	probably damaging	0.98
R6276:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R6366:Lama3	UTSW	18	12482137	missense	probably damaging	1.00
R6393:Lama3	UTSW	18	12479756	missense	probably benign	0.44
R6493:Lama3	UTSW	18	12482148	critical splice donor site	probably null
R6505:Lama3	UTSW	18	12495348	missense	probably benign	0.02
R6563:Lama3	UTSW	18	12537766	missense	probably damaging	1.00
R6582:Lama3	UTSW	18	12577840	missense	probably damaging	1.00
R6585:Lama3	UTSW	18	12419257	critical splice donor site	probably null
R6609:Lama3	UTSW	18	12513678	missense	probably damaging	0.99
R6656:Lama3	UTSW	18	12549226	missense	possibly damaging	0.66
R6833:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R6834:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R7019:Lama3	UTSW	18	12528418	missense	probably damaging	0.97
R7026:Lama3	UTSW	18	12516548	missense	probably damaging	0.98
R7088:Lama3	UTSW	18	12582545	missense	possibly damaging	0.90
R7100:Lama3	UTSW	18	12582644	missense	possibly damaging	0.80
R7102:Lama3	UTSW	18	12552813	missense	possibly damaging	0.66
R7103:Lama3	UTSW	18	12531879	missense	probably benign	0.00
R7121:Lama3	UTSW	18	12462782	missense	probably benign	0.06
R7133:Lama3	UTSW	18	12539786	missense	probably benign	0.05
R7150:Lama3	UTSW	18	12468289	missense	probably damaging	1.00
R7158:Lama3	UTSW	18	12456812	missense	probably benign	0.20
R7170:Lama3	UTSW	18	12404076	missense	probably benign	0.26
R7216:Lama3	UTSW	18	12430000	missense	probably damaging	1.00
R7223:Lama3	UTSW	18	12582608	missense	possibly damaging	0.53
R7243:Lama3	UTSW	18	12419845	missense	probably damaging	1.00
R7282:Lama3	UTSW	18	12439392	missense	probably damaging	0.99
R7337:Lama3	UTSW	18	12507040	splice site	probably null
R7442:Lama3	UTSW	18	12472181	critical splice acceptor site	probably null
R7487:Lama3	UTSW	18	12419237	missense	probably benign
R7604:Lama3	UTSW	18	12500493	missense	possibly damaging	0.93
R7609:Lama3	UTSW	18	12531834	critical splice acceptor site	probably null
R7650:Lama3	UTSW	18	12537838	missense	probably benign	0.01
R7894:Lama3	UTSW	18	12462807	missense	probably benign	0.07
R7975:Lama3	UTSW	18	12537739	missense	probably damaging	1.00
R8099:Lama3	UTSW	18	12534063	missense	probably damaging	0.97
R8168:Lama3	UTSW	18	12506942	missense	probably null
R8219:Lama3	UTSW	18	12439360	missense	probably benign	0.07
R8227:Lama3	UTSW	18	12407551	missense	probably benign
R8229:Lama3	UTSW	18	12407551	missense	probably benign
R8298:Lama3	UTSW	18	12525853	missense	probably benign	0.12
R8351:Lama3	UTSW	18	12540613	missense	probably damaging	1.00
R8364:Lama3	UTSW	18	12528347	missense	probably damaging	0.99
R8463:Lama3	UTSW	18	12449839	missense	probably damaging	0.96
R8515:Lama3	UTSW	18	12411631	missense	probably null	0.01
R8784:Lama3	UTSW	18	12421155	missense	probably benign
R8799:Lama3	UTSW	18	12490943	missense	probably damaging	0.96
R8874:Lama3	UTSW	18	12449586	critical splice donor site	probably null
R8938:Lama3	UTSW	18	12556705	missense	probably damaging	1.00
R8967:Lama3	UTSW	18	12532039	missense	possibly damaging	0.46
R9039:Lama3	UTSW	18	12481063	nonsense	probably null
R9126:Lama3	UTSW	18	12450470	missense	probably damaging	1.00
R9200:Lama3	UTSW	18	12472240	missense	probably benign	0.00
R9203:Lama3	UTSW	18	12462812	missense	probably benign	0.04
R9246:Lama3	UTSW	18	12577902	missense	probably damaging	0.99
R9284:Lama3	UTSW	18	12450484	nonsense	probably null
R9553:Lama3	UTSW	18	12429962	missense	probably damaging	1.00
R9716:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R9734:Lama3	UTSW	18	12549263	missense	possibly damaging	0.94
X0019:Lama3	UTSW	18	12582574	missense	possibly damaging	0.94
Z1177:Lama3	UTSW	18	12429879	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGTCTGTCTCAAGGGAAGGAATGC -3'
(R):5'- TGGGGAAGGACCACTTTGTAGTAGG -3'

Sequencing Primer
(F):5'- GAAGCTATTCATCCTGCACACTG -3'
(R):5'- tgtctgtgtgtctgtgtgtc -3'

Posted On

2014-04-13