Incidental Mutation 'R1558:4933406M09Rik'
Institutional Source Beutler Lab
Gene Symbol 4933406M09Rik
Ensembl Gene ENSMUSG00000050526
Gene NameRIKEN cDNA 4933406M09 gene
MMRRC Submission 039597-MU
Accession Numbers

NCBI RefSeq: NM_173771.4; MGI: 3045320

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosomal Location134385940-134390981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134390774 bp
Amino Acid Change Glycine to Aspartic acid at position 428 (G428D)
Ref Sequence ENSEMBL: ENSMUSP00000124251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162187]
Predicted Effect probably damaging
Transcript: ENSMUST00000162187
AA Change: G428D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124251
Gene: ENSMUSG00000050526
AA Change: G428D

Pfam:Glyco_transf_54 52 326 7.6e-79 PFAM
low complexity region 395 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)


Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in 4933406M09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:4933406M09Rik APN 1 134389958 missense probably damaging 1.00
IGL01862:4933406M09Rik APN 1 134390611 missense probably benign 0.03
P0005:4933406M09Rik UTSW 1 134387908 missense probably benign 0.00
R0498:4933406M09Rik UTSW 1 134390872 missense possibly damaging 0.69
R0563:4933406M09Rik UTSW 1 134390039 missense probably benign 0.00
R0731:4933406M09Rik UTSW 1 134389975 missense probably benign
R2146:4933406M09Rik UTSW 1 134390513 missense probably damaging 1.00
R2148:4933406M09Rik UTSW 1 134390513 missense probably damaging 1.00
R2901:4933406M09Rik UTSW 1 134390924 missense probably damaging 0.99
R3897:4933406M09Rik UTSW 1 134390438 missense possibly damaging 0.92
R4543:4933406M09Rik UTSW 1 134389793 missense probably benign 0.31
R4937:4933406M09Rik UTSW 1 134389976 missense probably benign 0.00
R5490:4933406M09Rik UTSW 1 134389928 missense probably damaging 1.00
R5684:4933406M09Rik UTSW 1 134389922 missense probably benign 0.04
R5823:4933406M09Rik UTSW 1 134390917 missense probably damaging 0.98
R6488:4933406M09Rik UTSW 1 134390888 missense probably damaging 1.00
R7177:4933406M09Rik UTSW 1 134390425 missense probably benign 0.08
R7201:4933406M09Rik UTSW 1 134390468 missense possibly damaging 0.69
R7671:4933406M09Rik UTSW 1 134390062 missense probably benign 0.27
R7749:4933406M09Rik UTSW 1 134390512 missense probably benign 0.45
R8385:4933406M09Rik UTSW 1 134390638 missense probably benign 0.00
Z1177:4933406M09Rik UTSW 1 134390158 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctctcggttttatctagctttgtg -3'
Posted On2014-04-13