Incidental Mutation 'R1558:Lrba'
ID170400
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene NameLPS-responsive beige-like anchor
SynonymsLba, D3Ertd775e
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location86224680-86782692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86351315 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1370 (G1370R)
Ref Sequence ENSEMBL: ENSMUSP00000148618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]
Predicted Effect probably damaging
Transcript: ENSMUST00000107635
AA Change: G1370R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: G1370R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192145
AA Change: G1370R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: G1370R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194759
AA Change: G1370R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: G1370R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195966
Predicted Effect probably damaging
Transcript: ENSMUST00000212390
AA Change: G1370R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86359782 missense probably benign 0.00
IGL00788:Lrba APN 3 86327685 missense probably damaging 0.97
IGL01139:Lrba APN 3 86642662 missense possibly damaging 0.88
IGL01302:Lrba APN 3 86295400 missense probably damaging 1.00
IGL01612:Lrba APN 3 86776177 missense possibly damaging 0.89
IGL01718:Lrba APN 3 86351248 missense probably damaging 1.00
IGL01719:Lrba APN 3 86327596 splice site probably benign
IGL01730:Lrba APN 3 86741424 missense possibly damaging 0.89
IGL01735:Lrba APN 3 86327661 missense probably benign 0.28
IGL01875:Lrba APN 3 86310047 missense probably damaging 1.00
IGL01884:Lrba APN 3 86310412 missense possibly damaging 0.86
IGL02264:Lrba APN 3 86780262 missense probably damaging 0.99
IGL02638:Lrba APN 3 86325073 missense probably damaging 0.97
IGL02647:Lrba APN 3 86359731 missense probably benign 0.00
IGL02664:Lrba APN 3 86325731 missense possibly damaging 0.84
IGL02728:Lrba APN 3 86776049 missense probably damaging 0.99
IGL02730:Lrba APN 3 86328199 missense probably damaging 1.00
IGL02883:Lrba APN 3 86354206 missense probably damaging 1.00
IGL02883:Lrba APN 3 86445413 missense probably damaging 0.99
IGL02948:Lrba APN 3 86310384 splice site probably null
IGL03090:Lrba APN 3 86773141 missense probably benign 0.01
molasses UTSW 3 86354307 critical splice donor site probably null
oscar UTSW 3 86350304 nonsense probably null
oscar2 UTSW 3 86664458 nonsense probably null
P0023:Lrba UTSW 3 86417935 missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86664494 nonsense probably null
R0077:Lrba UTSW 3 86542688 missense probably damaging 0.99
R0189:Lrba UTSW 3 86368509 missense probably damaging 1.00
R0217:Lrba UTSW 3 86642722 missense probably damaging 1.00
R0349:Lrba UTSW 3 86540005 missense probably damaging 1.00
R0396:Lrba UTSW 3 86295179 missense probably damaging 1.00
R0417:Lrba UTSW 3 86715654 missense probably damaging 1.00
R0536:Lrba UTSW 3 86715532 missense probably damaging 1.00
R0712:Lrba UTSW 3 86297990 nonsense probably null
R0722:Lrba UTSW 3 86605989 critical splice donor site probably null
R0828:Lrba UTSW 3 86608370 synonymous probably null
R0927:Lrba UTSW 3 86780233 missense probably damaging 1.00
R1120:Lrba UTSW 3 86295192 missense probably damaging 1.00
R1141:Lrba UTSW 3 86619558 missense probably damaging 1.00
R1276:Lrba UTSW 3 86664526 missense probably damaging 1.00
R1449:Lrba UTSW 3 86354278 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1474:Lrba UTSW 3 86780266 splice site probably benign
R1596:Lrba UTSW 3 86350304 nonsense probably null
R1652:Lrba UTSW 3 86539938 missense probably damaging 1.00
R1800:Lrba UTSW 3 86351868 missense probably benign 0.00
R1819:Lrba UTSW 3 86542634 missense possibly damaging 0.80
R1862:Lrba UTSW 3 86773203 critical splice donor site probably null
R1917:Lrba UTSW 3 86664501 missense probably damaging 1.00
R1965:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1966:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1969:Lrba UTSW 3 86608389 missense probably damaging 0.99
R2011:Lrba UTSW 3 86310017 missense probably damaging 0.99
R2179:Lrba UTSW 3 86354281 missense probably damaging 1.00
R2186:Lrba UTSW 3 86304336 missense probably damaging 1.00
R2281:Lrba UTSW 3 86776103 missense possibly damaging 0.46
R2359:Lrba UTSW 3 86348750 missense probably benign 0.01
R2412:Lrba UTSW 3 86327700 missense probably damaging 1.00
R2496:Lrba UTSW 3 86532087 missense probably damaging 1.00
R3153:Lrba UTSW 3 86285219 missense probably damaging 0.99
R3708:Lrba UTSW 3 86285024 missense possibly damaging 0.80
R3746:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3747:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3748:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3749:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3750:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3758:Lrba UTSW 3 86776049 missense probably damaging 0.99
R3975:Lrba UTSW 3 86351255 missense probably damaging 1.00
R4210:Lrba UTSW 3 86360126 missense probably damaging 1.00
R4258:Lrba UTSW 3 86445349 missense probably damaging 1.00
R4657:Lrba UTSW 3 86737164 missense probably damaging 1.00
R4713:Lrba UTSW 3 86359868 missense probably benign 0.13
R4716:Lrba UTSW 3 86642714 missense probably damaging 0.99
R4811:Lrba UTSW 3 86776141 missense probably damaging 1.00
R4827:Lrba UTSW 3 86360150 missense possibly damaging 0.85
R4840:Lrba UTSW 3 86619509 critical splice acceptor site probably null
R4920:Lrba UTSW 3 86664458 nonsense probably null
R4948:Lrba UTSW 3 86285028 missense probably damaging 1.00
R4970:Lrba UTSW 3 86225371 missense probably benign 0.23
R4985:Lrba UTSW 3 86327436 intron probably null
R4993:Lrba UTSW 3 86360037 missense probably damaging 1.00
R5107:Lrba UTSW 3 86359779 missense possibly damaging 0.47
R5112:Lrba UTSW 3 86225371 missense probably benign 0.23
R5122:Lrba UTSW 3 86349154 nonsense probably null
R5155:Lrba UTSW 3 86351300 missense probably benign 0.25
R5194:Lrba UTSW 3 86328219 missense probably damaging 1.00
R5280:Lrba UTSW 3 86325022 missense possibly damaging 0.94
R5445:Lrba UTSW 3 86368595 missense probably benign
R5469:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5513:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5578:Lrba UTSW 3 86757507 missense probably benign 0.27
R5740:Lrba UTSW 3 86328342 missense probably damaging 1.00
R5868:Lrba UTSW 3 86319604 missense probably damaging 1.00
R6104:Lrba UTSW 3 86353792 missense probably damaging 1.00
R6166:Lrba UTSW 3 86354307 critical splice donor site probably null
R6279:Lrba UTSW 3 86348864 missense probably benign 0.26
R6330:Lrba UTSW 3 86348357 missense probably benign 0.07
R6367:Lrba UTSW 3 86368562 missense probably benign 0.42
R6571:Lrba UTSW 3 86360060 missense probably damaging 1.00
R6584:Lrba UTSW 3 86664576 missense probably damaging 1.00
R6698:Lrba UTSW 3 86304425 missense probably damaging 0.99
R6763:Lrba UTSW 3 86354263 missense probably damaging 1.00
R6834:Lrba UTSW 3 86350286 missense probably benign 0.00
R6951:Lrba UTSW 3 86745873 missense probably benign 0.01
R6969:Lrba UTSW 3 86619590 missense probably benign 0.21
R7045:Lrba UTSW 3 86285091 missense probably benign 0.03
R7133:Lrba UTSW 3 86394931 intron probably null
R7182:Lrba UTSW 3 86741458 frame shift probably null
R7214:Lrba UTSW 3 86328326 missense probably damaging 1.00
R7224:Lrba UTSW 3 86395246 missense probably damaging 1.00
R7243:Lrba UTSW 3 86751516 splice site probably null
R7350:Lrba UTSW 3 86351902 missense probably damaging 0.96
R7380:Lrba UTSW 3 86325074 missense probably damaging 1.00
R7492:Lrba UTSW 3 86664528 missense probably damaging 1.00
R7651:Lrba UTSW 3 86741466 nonsense probably null
R7729:Lrba UTSW 3 86318167 missense probably damaging 1.00
X0065:Lrba UTSW 3 86297899 missense probably damaging 1.00
X0065:Lrba UTSW 3 86325089 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGACTTCTGACAGAGTGGTTTGC -3'
(R):5'- GGCTCAATGTTCTCCAGCTCATGC -3'

Sequencing Primer
(F):5'- GCCTCTCCTTAAGCAGGTATATGG -3'
(R):5'- agaaagtgggggggagg -3'
Posted On2014-04-13