Mutagenetix > Incidental Mutations

Incidental Mutation 'R1558:Abca1'

170405

Institutional Source

Beutler Lab

Gene Symbol

Abca1

Ensembl Gene

ENSMUSG00000015243

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 1

Synonyms

ABC1

MMRRC Submission

039597-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1558 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53030787-53159895 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53092887 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 299 (Q299L)

Ref Sequence

ENSEMBL: ENSMUSP00000030010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030010]

Predicted Effect

probably null
Transcript: ENSMUST00000030010
AA Change: Q299L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: Q299L

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
Pfam:ABC2_membrane_3	395	841	4.9e-14	PFAM
AAA	925	1122	4.2e-10	SMART
low complexity region	1137	1150	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1344	1869	1.7e-53	PFAM
low complexity region	1890	1899	N/A	INTRINSIC
AAA	1938	2123	3.04e-7	SMART
low complexity region	2176	2187	N/A	INTRINSIC
low complexity region	2222	2237	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,065,705	I708F	probably benign	Het
4933406M09Rik	G	A	1: 134,390,774	G428D	probably damaging	Het
Adamts9	T	G	6: 92,908,711	K399N	possibly damaging	Het
Alox12b	T	C	11: 69,165,885	F369S	probably damaging	Het
Alpk2	A	G	18: 65,350,230	Y236H	probably benign	Het
Ankrd36	T	C	11: 5,635,329	L380P	probably damaging	Het
Atp2a1	C	T	7: 126,452,672	A468T	possibly damaging	Het
Caprin1	A	T	2: 103,775,987	F303I	possibly damaging	Het
Casp7	A	T	19: 56,433,252	R41*	probably null	Het
Ccdc66	T	A	14: 27,486,506	H753L	probably benign	Het
Ccnc	T	C	4: 21,742,671	M166T	probably benign	Het
Cdkl3	T	A	11: 52,032,510	M538K	possibly damaging	Het
Cercam	G	A	2: 29,876,239	A345T	probably benign	Het
Chmp3	T	A	6: 71,560,970	C60*	probably null	Het
Ddx1	C	T	12: 13,239,541	G125S	probably damaging	Het
Defb7	A	G	8: 19,497,551	D24G	probably benign	Het
Dgcr8	A	T	16: 18,259,588	Y653N	probably damaging	Het
Dsc2	T	C	18: 20,050,151	D70G	probably damaging	Het
Erich3	T	G	3: 154,714,068	N266K	probably damaging	Het
Fastk	A	T	5: 24,444,047		probably null	Het
Fat4	A	G	3: 38,888,986	N676S	probably damaging	Het
Fermt1	A	T	2: 132,934,819		probably null	Het
Fmn1	A	G	2: 113,693,118	T1149A	possibly damaging	Het
Foxo3	A	G	10: 42,197,072	V483A	probably damaging	Het
Fpgs	T	C	2: 32,685,840	T364A	possibly damaging	Het
Gm12185	A	G	11: 48,915,435	S310P	probably damaging	Het
Gm15056	A	T	8: 20,901,933		probably benign	Het
Hcn1	T	C	13: 117,975,576	V692A	unknown	Het
Izumo3	A	C	4: 92,146,903	C26G	probably damaging	Het
Kcnf1	T	C	12: 17,175,473	Y249C	probably damaging	Het
Kcnj6	T	C	16: 94,762,499	E380G	possibly damaging	Het
Kdm3b	A	G	18: 34,809,096	T747A	probably damaging	Het
Lrba	G	A	3: 86,351,315	G1370R	probably damaging	Het
Mei1	G	A	15: 82,107,133	R504Q	probably damaging	Het
Mipol1	T	C	12: 57,332,341	I195T	probably damaging	Het
Mum1	G	T	10: 80,232,944	R307S	probably benign	Het
Ncor2	G	A	5: 125,033,546	T1350I	probably damaging	Het
Npy	A	G	6: 49,823,725	E43G	probably damaging	Het
Olfr1152	T	A	2: 87,868,115	N41K	probably damaging	Het
Olfr1507	T	A	14: 52,490,146	I273F	probably benign	Het
Olfr924	T	A	9: 38,848,904	N263K	probably benign	Het
Pcdhb3	T	C	18: 37,301,581	L200P	probably damaging	Het
Pcnt	G	A	10: 76,422,922	H570Y	possibly damaging	Het
Pkd1l2	A	C	8: 117,082,252	D66E	possibly damaging	Het
Plekhg4	A	G	8: 105,381,835	D1170G	possibly damaging	Het
Poln	T	A	5: 34,032,799	H672L	probably benign	Het
Pqlc2	A	T	4: 139,300,080		probably benign	Het
Ptprq	T	C	10: 107,644,043	Y1122C	probably damaging	Het
Ptrhd1	A	G	12: 4,236,505	Y132C	probably damaging	Het
Riok1	G	T	13: 38,050,855	R300L	probably damaging	Het
Sbf2	G	T	7: 110,428,346	T481K	probably damaging	Het
Sidt2	A	T	9: 45,951,800	M11K	probably damaging	Het
Syne1	G	A	10: 5,349,280	R992*	probably null	Het
Tmem2	T	A	19: 21,797,982	Y196*	probably null	Het
Tmem8b	C	A	4: 43,681,134	R384S	possibly damaging	Het
Trim28	T	C	7: 13,027,834	Y243H	probably damaging	Het
Trpm6	T	C	19: 18,786,828	M266T	probably benign	Het
Tsg101	A	T	7: 46,889,689	S368T	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Ttc6	G	A	12: 57,686,346	V1092I	probably benign	Het
Vps13b	C	T	15: 35,534,319	T927I	probably damaging	Het
Zfr	C	T	15: 12,140,644	T259I	unknown	Het

Other mutations in Abca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Abca1	APN	4	53059255	critical splice donor site	probably null
IGL00778:Abca1	APN	4	53086132	missense	probably benign
IGL01013:Abca1	APN	4	53038185	nonsense	probably null
IGL01510:Abca1	APN	4	53143979	missense	probably damaging	0.97
IGL01608:Abca1	APN	4	53038158	missense	probably damaging	1.00
IGL01845:Abca1	APN	4	53090297	missense	probably damaging	1.00
IGL02048:Abca1	APN	4	53069831	missense	probably damaging	1.00
IGL02249:Abca1	APN	4	53068739	nonsense	probably null
IGL02569:Abca1	APN	4	53034061	missense	probably damaging	1.00
IGL02622:Abca1	APN	4	53034046	missense	probably damaging	0.99
R6720_abca1_529	UTSW	4	53083733	missense	probably damaging	1.00
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0050:Abca1	UTSW	4	53069910	splice site	probably benign
R0107:Abca1	UTSW	4	53080834	missense	probably benign	0.00
R0127:Abca1	UTSW	4	53067155	missense	probably benign	0.00
R0178:Abca1	UTSW	4	53081953	missense	possibly damaging	0.89
R0207:Abca1	UTSW	4	53086039	missense	probably damaging	0.97
R0267:Abca1	UTSW	4	53046105	missense	probably damaging	1.00
R0269:Abca1	UTSW	4	53044228	missense	probably benign
R0586:Abca1	UTSW	4	53092860	missense	probably benign	0.00
R0587:Abca1	UTSW	4	53107035	missense	probably benign	0.00
R1403:Abca1	UTSW	4	53059253	splice site	probably benign
R1404:Abca1	UTSW	4	53059253	splice site	probably benign
R1405:Abca1	UTSW	4	53059253	splice site	probably benign
R1655:Abca1	UTSW	4	53050964	missense	probably benign
R1662:Abca1	UTSW	4	53090251	splice site	probably null
R1769:Abca1	UTSW	4	53074325	missense	probably damaging	1.00
R1898:Abca1	UTSW	4	53071977	missense	probably benign	0.08
R1945:Abca1	UTSW	4	53061509	frame shift	probably null
R1966:Abca1	UTSW	4	53050409	missense	probably damaging	1.00
R2055:Abca1	UTSW	4	53069881	missense	probably benign
R2185:Abca1	UTSW	4	53089830	missense	probably benign	0.12
R2202:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2203:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2204:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R3056:Abca1	UTSW	4	53127626	missense	probably benign
R3849:Abca1	UTSW	4	53061481	splice site	probably benign
R3850:Abca1	UTSW	4	53061481	splice site	probably benign
R3906:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R3908:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R4050:Abca1	UTSW	4	53044144	missense	probably damaging	1.00
R4204:Abca1	UTSW	4	53090369	missense	probably benign	0.00
R4225:Abca1	UTSW	4	53085106	missense	possibly damaging	0.87
R4577:Abca1	UTSW	4	53062568	missense	possibly damaging	0.94
R4979:Abca1	UTSW	4	53085092	splice site	probably null
R5022:Abca1	UTSW	4	53041570	frame shift	probably null
R5168:Abca1	UTSW	4	53086070	missense	probably benign
R5363:Abca1	UTSW	4	53132963	missense	probably benign	0.00
R5439:Abca1	UTSW	4	53042381	missense	possibly damaging	0.55
R5604:Abca1	UTSW	4	53067168	splice site	probably null
R5614:Abca1	UTSW	4	53046132	missense	probably damaging	1.00
R5810:Abca1	UTSW	4	53079631	missense	probably benign
R6001:Abca1	UTSW	4	53075555	missense	possibly damaging	0.68
R6151:Abca1	UTSW	4	53085261	missense	probably benign
R6185:Abca1	UTSW	4	53078089	missense	probably benign	0.31
R6262:Abca1	UTSW	4	53092917	missense	probably benign	0.01
R6455:Abca1	UTSW	4	53042376	missense	probably damaging	0.98
R6472:Abca1	UTSW	4	53085991	critical splice donor site	probably null
R6564:Abca1	UTSW	4	53034031	missense	possibly damaging	0.85
R6720:Abca1	UTSW	4	53083733	missense	probably damaging	1.00
R6903:Abca1	UTSW	4	53143952	missense	probably benign	0.17
R6960:Abca1	UTSW	4	53072924	missense	probably benign	0.00
R7065:Abca1	UTSW	4	53074233	missense	probably damaging	0.98
R7142:Abca1	UTSW	4	53082050	missense	probably damaging	1.00
R7322:Abca1	UTSW	4	53067151	missense	probably damaging	0.97
R7520:Abca1	UTSW	4	53078114	missense	probably benign
R7547:Abca1	UTSW	4	53109269	missense	probably benign	0.02
R7793:Abca1	UTSW	4	53042367	missense	not run
RF005:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
RF024:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
X0023:Abca1	UTSW	4	53049038	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGGCTTTGGTCTGCATAGTCAACTC -3'
(R):5'- GCCTGGAAGATGAATGGTTACCCTC -3'

Sequencing Primer
(F):5'- GGTCTGCATAGTCAACTCACTTG -3'
(R):5'- GCTAGACACAGTATGTTCTGCAAC -3'

Posted On

2014-04-13