Incidental Mutation 'R1558:Tsg101'
ID170417
Institutional Source Beutler Lab
Gene Symbol Tsg101
Ensembl Gene ENSMUSG00000014402
Gene Nametumor susceptibility gene 101
SynonymsCC2
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46888949-46919969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46889689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 368 (S368T)
Ref Sequence ENSEMBL: ENSMUSP00000014546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014546] [ENSMUST00000156335] [ENSMUST00000209538] [ENSMUST00000211076]
Predicted Effect probably damaging
Transcript: ENSMUST00000014546
AA Change: S368T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014546
Gene: ENSMUSG00000014402
AA Change: S368T

DomainStartEndE-ValueType
UBCc 22 177 5.96e-4 SMART
PDB:3IV1|H 229 305 1e-43 PDB
Pfam:Vps23_core 317 380 2.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146130
Predicted Effect probably benign
Transcript: ENSMUST00000156335
SMART Domains Protein: ENSMUSP00000120856
Gene: ENSMUSG00000014402

DomainStartEndE-ValueType
UBCc 51 206 5.96e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209538
AA Change: S230T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211076
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced growth, fail to form mesoderm, accumulate p53 protein and die by embryonic day 6.5. Homozygotes for a mammary gland-specific knockout show impaired mammogenesis and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Tsg101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Tsg101 APN 7 46908925 missense probably damaging 1.00
IGL01505:Tsg101 APN 7 46909060 missense probably damaging 1.00
R1183:Tsg101 UTSW 7 46889624 missense probably benign 0.23
R1560:Tsg101 UTSW 7 46892460 unclassified probably null
R1779:Tsg101 UTSW 7 46907087 missense probably benign 0.00
R2015:Tsg101 UTSW 7 46908904 critical splice donor site probably null
R2329:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R3773:Tsg101 UTSW 7 46889615 makesense probably null
R4108:Tsg101 UTSW 7 46892494 missense probably damaging 1.00
R4618:Tsg101 UTSW 7 46892509 missense possibly damaging 0.76
R5162:Tsg101 UTSW 7 46892426 missense probably damaging 1.00
R5380:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R5537:Tsg101 UTSW 7 46891128 missense probably benign 0.02
R6939:Tsg101 UTSW 7 46907099 missense probably benign 0.00
R7555:Tsg101 UTSW 7 46913411 missense probably damaging 1.00
R7752:Tsg101 UTSW 7 46913435 missense probably benign 0.01
X0063:Tsg101 UTSW 7 46889631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGACGCTTACAGAGGGTAGA -3'
(R):5'- GGGACAGTTTGAAAACTTGTACCAAGCA -3'

Sequencing Primer
(F):5'- AAGCCAGTTTTTACCCAAAGG -3'
(R):5'- TGACTGGATCAACGCGTT -3'
Posted On2014-04-13