Incidental Mutation 'R1558:Sbf2'
ID170418
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene NameSET binding factor 2
SynonymsmMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
MMRRC Submission 039597-MU
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location110308013-110614922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110428346 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 481 (T481K)
Ref Sequence ENSEMBL: ENSMUSP00000132072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033058
AA Change: T481K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: T481K

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163579
Predicted Effect unknown
Transcript: ENSMUST00000164559
AA Change: T88K
SMART Domains Protein: ENSMUSP00000128265
Gene: ENSMUSG00000038371
AA Change: T88K

DomainStartEndE-ValueType
dDENN 2 74 3.04e-2 SMART
Pfam:SBF2 138 177 1.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164759
AA Change: T481K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: T481K

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165449
Predicted Effect probably damaging
Transcript: ENSMUST00000166020
AA Change: T435K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: T435K

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171378
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0121:Sbf2 UTSW 7 110489219 critical splice donor site probably null
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6142:Sbf2 UTSW 7 110348975 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R6986:Sbf2 UTSW 7 110330615 missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110614716 nonsense probably null
R7556:Sbf2 UTSW 7 110314053 missense probably benign 0.20
R7604:Sbf2 UTSW 7 110378067 missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 110330713 critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110441426 missense probably benign 0.01
R7812:Sbf2 UTSW 7 110449963 missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 110372510 missense probably damaging 1.00
R8026:Sbf2 UTSW 7 110335387 missense probably damaging 1.00
R8048:Sbf2 UTSW 7 110315082 missense probably benign 0.21
R8305:Sbf2 UTSW 7 110371618 missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110441462 missense probably benign
RF005:Sbf2 UTSW 7 110317008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGGGTGGACCTGCTGG -3'
(R):5'- GACAACCAACTGTCTGAGATACTGCTG -3'

Sequencing Primer
(F):5'- gctggcactacacatttcttttc -3'
(R):5'- CTTGGAGAAAGAACCTGGTATTCTG -3'
Posted On2014-04-13