Mutagenetix > Incidental Mutations

Incidental Mutation 'R1558:Ptprq'

170430

Institutional Source

Beutler Lab

Gene Symbol

Ptprq

Ensembl Gene

ENSMUSG00000035916

Gene Name

protein tyrosine phosphatase, receptor type, Q

Synonyms

MMRRC Submission

039597-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R1558 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107517049-107720051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107644043 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1122 (Y1122C)

Ref Sequence

ENSEMBL: ENSMUSP00000058572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050702]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050702
AA Change: Y1122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: Y1122C

Domain	Start	End	E-Value	Type
FN3	57	141	3.17e-13	SMART
FN3	156	294	1.55e-7	SMART
FN3	307	384	4.45e-8	SMART
FN3	398	555	1.17e-7	SMART
FN3	569	648	7.06e-11	SMART
FN3	666	743	7.68e-12	SMART
FN3	760	839	1.88e-6	SMART
FN3	855	932	1.33e-6	SMART
FN3	949	1037	2.31e-6	SMART
FN3	1054	1135	1.24e-6	SMART
FN3	1151	1229	2.39e-8	SMART
FN3	1244	1325	6.29e-8	SMART
FN3	1341	1416	2.87e-11	SMART
FN3	1431	1524	2.82e-10	SMART
FN3	1540	1622	6.35e-4	SMART
FN3	1642	1732	7.93e-5	SMART
transmembrane domain	1907	1929	N/A	INTRINSIC
PTPc	2003	2262	1.14e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218399

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,065,705	I708F	probably benign	Het
4933406M09Rik	G	A	1: 134,390,774	G428D	probably damaging	Het
Abca1	T	A	4: 53,092,887	Q299L	probably null	Het
Adamts9	T	G	6: 92,908,711	K399N	possibly damaging	Het
Alox12b	T	C	11: 69,165,885	F369S	probably damaging	Het
Alpk2	A	G	18: 65,350,230	Y236H	probably benign	Het
Ankrd36	T	C	11: 5,635,329	L380P	probably damaging	Het
Atp2a1	C	T	7: 126,452,672	A468T	possibly damaging	Het
Caprin1	A	T	2: 103,775,987	F303I	possibly damaging	Het
Casp7	A	T	19: 56,433,252	R41*	probably null	Het
Ccdc66	T	A	14: 27,486,506	H753L	probably benign	Het
Ccnc	T	C	4: 21,742,671	M166T	probably benign	Het
Cdkl3	T	A	11: 52,032,510	M538K	possibly damaging	Het
Cercam	G	A	2: 29,876,239	A345T	probably benign	Het
Chmp3	T	A	6: 71,560,970	C60*	probably null	Het
Ddx1	C	T	12: 13,239,541	G125S	probably damaging	Het
Defb7	A	G	8: 19,497,551	D24G	probably benign	Het
Dgcr8	A	T	16: 18,259,588	Y653N	probably damaging	Het
Dsc2	T	C	18: 20,050,151	D70G	probably damaging	Het
Erich3	T	G	3: 154,714,068	N266K	probably damaging	Het
Fastk	A	T	5: 24,444,047		probably null	Het
Fat4	A	G	3: 38,888,986	N676S	probably damaging	Het
Fermt1	A	T	2: 132,934,819		probably null	Het
Fmn1	A	G	2: 113,693,118	T1149A	possibly damaging	Het
Foxo3	A	G	10: 42,197,072	V483A	probably damaging	Het
Fpgs	T	C	2: 32,685,840	T364A	possibly damaging	Het
Gm12185	A	G	11: 48,915,435	S310P	probably damaging	Het
Gm15056	A	T	8: 20,901,933		probably benign	Het
Hcn1	T	C	13: 117,975,576	V692A	unknown	Het
Izumo3	A	C	4: 92,146,903	C26G	probably damaging	Het
Kcnf1	T	C	12: 17,175,473	Y249C	probably damaging	Het
Kcnj6	T	C	16: 94,762,499	E380G	possibly damaging	Het
Kdm3b	A	G	18: 34,809,096	T747A	probably damaging	Het
Lrba	G	A	3: 86,351,315	G1370R	probably damaging	Het
Mei1	G	A	15: 82,107,133	R504Q	probably damaging	Het
Mipol1	T	C	12: 57,332,341	I195T	probably damaging	Het
Mum1	G	T	10: 80,232,944	R307S	probably benign	Het
Ncor2	G	A	5: 125,033,546	T1350I	probably damaging	Het
Npy	A	G	6: 49,823,725	E43G	probably damaging	Het
Olfr1152	T	A	2: 87,868,115	N41K	probably damaging	Het
Olfr1507	T	A	14: 52,490,146	I273F	probably benign	Het
Olfr924	T	A	9: 38,848,904	N263K	probably benign	Het
Pcdhb3	T	C	18: 37,301,581	L200P	probably damaging	Het
Pcnt	G	A	10: 76,422,922	H570Y	possibly damaging	Het
Pkd1l2	A	C	8: 117,082,252	D66E	possibly damaging	Het
Plekhg4	A	G	8: 105,381,835	D1170G	possibly damaging	Het
Poln	T	A	5: 34,032,799	H672L	probably benign	Het
Pqlc2	A	T	4: 139,300,080		probably benign	Het
Ptrhd1	A	G	12: 4,236,505	Y132C	probably damaging	Het
Riok1	G	T	13: 38,050,855	R300L	probably damaging	Het
Sbf2	G	T	7: 110,428,346	T481K	probably damaging	Het
Sidt2	A	T	9: 45,951,800	M11K	probably damaging	Het
Syne1	G	A	10: 5,349,280	R992*	probably null	Het
Tmem2	T	A	19: 21,797,982	Y196*	probably null	Het
Tmem8b	C	A	4: 43,681,134	R384S	possibly damaging	Het
Trim28	T	C	7: 13,027,834	Y243H	probably damaging	Het
Trpm6	T	C	19: 18,786,828	M266T	probably benign	Het
Tsg101	A	T	7: 46,889,689	S368T	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Ttc6	G	A	12: 57,686,346	V1092I	probably benign	Het
Vps13b	C	T	15: 35,534,319	T927I	probably damaging	Het
Zfr	C	T	15: 12,140,644	T259I	unknown	Het

Other mutations in Ptprq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptprq	APN	10	107576929	missense	probably damaging	0.98
IGL00537:Ptprq	APN	10	107710522	missense	probably benign	0.07
IGL00547:Ptprq	APN	10	107718541	missense	probably damaging	0.99
IGL00586:Ptprq	APN	10	107608122	splice site	probably benign
IGL00648:Ptprq	APN	10	107646716	missense	probably benign	0.10
IGL01123:Ptprq	APN	10	107686218	missense	probably damaging	0.96
IGL01343:Ptprq	APN	10	107638839	missense	probably damaging	0.96
IGL01348:Ptprq	APN	10	107711904	missense	probably damaging	1.00
IGL01433:Ptprq	APN	10	107576880	missense	probably damaging	0.99
IGL01510:Ptprq	APN	10	107712048	missense	probably damaging	1.00
IGL01535:Ptprq	APN	10	107699596	missense	probably benign
IGL01631:Ptprq	APN	10	107643538	missense	probably benign	0.00
IGL01633:Ptprq	APN	10	107699723	splice site	probably benign
IGL01702:Ptprq	APN	10	107517866	missense	probably benign	0.00
IGL01733:Ptprq	APN	10	107662599	missense	probably benign	0.10
IGL01806:Ptprq	APN	10	107699608	missense	probably damaging	1.00
IGL01832:Ptprq	APN	10	107565839	critical splice donor site	probably null
IGL01961:Ptprq	APN	10	107643654	missense	probably damaging	1.00
IGL02108:Ptprq	APN	10	107646617	missense	probably damaging	1.00
IGL02120:Ptprq	APN	10	107667472	missense	probably damaging	1.00
IGL02160:Ptprq	APN	10	107653565	missense	probably benign	0.00
IGL02178:Ptprq	APN	10	107686319	missense	probably benign	0.03
IGL02249:Ptprq	APN	10	107582359	missense	probably damaging	1.00
IGL02267:Ptprq	APN	10	107646558	missense	probably damaging	1.00
IGL02527:Ptprq	APN	10	107686563	missense	probably benign	0.04
IGL02529:Ptprq	APN	10	107635365	missense	probably benign	0.03
IGL02542:Ptprq	APN	10	107662555	missense	probably damaging	1.00
IGL02582:Ptprq	APN	10	107643999	missense	probably benign	0.00
IGL02708:Ptprq	APN	10	107652700	missense	probably damaging	1.00
IGL02894:Ptprq	APN	10	107667424	missense	probably benign
IGL02903:Ptprq	APN	10	107666586	missense	possibly damaging	0.51
IGL02951:Ptprq	APN	10	107667460	missense	probably benign	0.03
IGL02982:Ptprq	APN	10	107586684	missense	probably damaging	1.00
IGL03000:Ptprq	APN	10	107542657	missense	probably damaging	1.00
IGL03024:Ptprq	APN	10	107685566	missense	possibly damaging	0.69
IGL03240:Ptprq	APN	10	107688507	missense	probably benign
P0043:Ptprq	UTSW	10	107580225	missense	probably benign	0.03
PIT4812001:Ptprq	UTSW	10	107666567	missense	probably damaging	1.00
R0200:Ptprq	UTSW	10	107685157	missense	probably benign
R0268:Ptprq	UTSW	10	107705548	missense	probably benign
R0276:Ptprq	UTSW	10	107542735	critical splice acceptor site	probably null
R0279:Ptprq	UTSW	10	107608417	missense	probably damaging	0.96
R0335:Ptprq	UTSW	10	107708728	missense	probably benign
R0344:Ptprq	UTSW	10	107705582	missense	probably benign
R0357:Ptprq	UTSW	10	107686199	splice site	probably benign
R0454:Ptprq	UTSW	10	107582530	nonsense	probably null
R0479:Ptprq	UTSW	10	107643994	nonsense	probably null
R0491:Ptprq	UTSW	10	107608175	missense	probably damaging	0.98
R0519:Ptprq	UTSW	10	107538920	splice site	probably benign
R0523:Ptprq	UTSW	10	107580220	missense	possibly damaging	0.54
R0553:Ptprq	UTSW	10	107710627	missense	probably benign	0.33
R0746:Ptprq	UTSW	10	107517831	missense	probably damaging	1.00
R0755:Ptprq	UTSW	10	107582539	missense	probably benign	0.09
R1434:Ptprq	UTSW	10	107586714	missense	probably damaging	1.00
R1445:Ptprq	UTSW	10	107662562	missense	probably damaging	1.00
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1567:Ptprq	UTSW	10	107565887	missense	probably benign	0.13
R1711:Ptprq	UTSW	10	107534699	nonsense	probably null
R1720:Ptprq	UTSW	10	107686294	missense	probably damaging	1.00
R1746:Ptprq	UTSW	10	107638830	missense	probably damaging	1.00
R1776:Ptprq	UTSW	10	107685089	missense	probably damaging	1.00
R1822:Ptprq	UTSW	10	107718478	missense	probably damaging	1.00
R1872:Ptprq	UTSW	10	107643999	missense	probably benign	0.19
R1944:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R1945:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R2006:Ptprq	UTSW	10	107666546	missense	probably damaging	1.00
R2014:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2015:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2097:Ptprq	UTSW	10	107653493	missense	probably benign	0.05
R2172:Ptprq	UTSW	10	107590994	nonsense	probably null
R2174:Ptprq	UTSW	10	107705553	missense	probably damaging	1.00
R2248:Ptprq	UTSW	10	107643070	splice site	probably null
R2404:Ptprq	UTSW	10	107686599	missense	probably damaging	1.00
R3423:Ptprq	UTSW	10	107582476	missense	probably damaging	0.99
R3683:Ptprq	UTSW	10	107708628	missense	probably benign	0.01
R3875:Ptprq	UTSW	10	107685104	missense	possibly damaging	0.88
R3945:Ptprq	UTSW	10	107686392	splice site	probably benign
R3946:Ptprq	UTSW	10	107686392	splice site	probably benign
R3974:Ptprq	UTSW	10	107712062	missense	possibly damaging	0.88
R3982:Ptprq	UTSW	10	107543396	missense	probably damaging	0.99
R4105:Ptprq	UTSW	10	107572967	missense	probably damaging	1.00
R4118:Ptprq	UTSW	10	107711920	missense	probably benign	0.37
R4175:Ptprq	UTSW	10	107711917	missense	probably benign
R4231:Ptprq	UTSW	10	107686283	nonsense	probably null
R4356:Ptprq	UTSW	10	107608364	missense	probably damaging	0.99
R4435:Ptprq	UTSW	10	107685055	missense	possibly damaging	0.89
R4678:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4679:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4745:Ptprq	UTSW	10	107524253	missense	probably damaging	1.00
R4771:Ptprq	UTSW	10	107688427	missense	probably benign
R4778:Ptprq	UTSW	10	107591022	missense	probably benign	0.15
R4808:Ptprq	UTSW	10	107718507	missense	probably damaging	1.00
R4809:Ptprq	UTSW	10	107563175	missense	probably damaging	1.00
R4818:Ptprq	UTSW	10	107710581	missense	possibly damaging	0.86
R4845:Ptprq	UTSW	10	107653532	missense	probably benign	0.00
R4901:Ptprq	UTSW	10	107688414	missense	probably benign	0.01
R4942:Ptprq	UTSW	10	107688429	missense	probably benign	0.01
R4946:Ptprq	UTSW	10	107525734	missense	probably benign
R4959:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R4973:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R5007:Ptprq	UTSW	10	107608276	missense	probably benign	0.00
R5053:Ptprq	UTSW	10	107563202	missense	probably damaging	1.00
R5055:Ptprq	UTSW	10	107534679	missense	probably benign	0.37
R5090:Ptprq	UTSW	10	107526089	missense	probably damaging	1.00
R5158:Ptprq	UTSW	10	107534704	missense	probably damaging	1.00
R5163:Ptprq	UTSW	10	107524331	missense	probably damaging	1.00
R5222:Ptprq	UTSW	10	107662564	missense	probably damaging	0.96
R5244:Ptprq	UTSW	10	107586695	missense	possibly damaging	0.62
R5249:Ptprq	UTSW	10	107699635	missense	probably damaging	0.99
R5503:Ptprq	UTSW	10	107688328	splice site	probably null
R5508:Ptprq	UTSW	10	107686231	missense	probably benign	0.00
R5601:Ptprq	UTSW	10	107608430	missense	probably benign
R5722:Ptprq	UTSW	10	107686365	missense	possibly damaging	0.72
R5819:Ptprq	UTSW	10	107719883	start gained	probably benign
R5862:Ptprq	UTSW	10	107565878	missense	probably benign	0.02
R5891:Ptprq	UTSW	10	107576895	missense	possibly damaging	0.94
R5916:Ptprq	UTSW	10	107523513	missense	probably damaging	1.00
R6054:Ptprq	UTSW	10	107582358	missense	probably damaging	1.00
R6058:Ptprq	UTSW	10	107635274	missense	probably benign	0.00
R6075:Ptprq	UTSW	10	107525760	missense	probably damaging	1.00
R6101:Ptprq	UTSW	10	107580266	missense	possibly damaging	0.93
R6189:Ptprq	UTSW	10	107517887	missense	probably damaging	1.00
R6235:Ptprq	UTSW	10	107635338	missense	possibly damaging	0.61
R6351:Ptprq	UTSW	10	107708668	missense	probably damaging	0.99
R6394:Ptprq	UTSW	10	107642943	nonsense	probably null
R6449:Ptprq	UTSW	10	107705583	missense	probably benign	0.00
R6526:Ptprq	UTSW	10	107542653	nonsense	probably null
R6544:Ptprq	UTSW	10	107608241	missense	probably damaging	1.00
R6609:Ptprq	UTSW	10	107572968	missense	probably damaging	0.99
R6862:Ptprq	UTSW	10	107686225	missense	probably damaging	0.96
R6874:Ptprq	UTSW	10	107718599	missense	possibly damaging	0.80
R6892:Ptprq	UTSW	10	107576004	missense	probably benign	0.00
R7082:Ptprq	UTSW	10	107708730	missense	probably benign	0.10
R7210:Ptprq	UTSW	10	107685171	missense	probably damaging	1.00
R7253:Ptprq	UTSW	10	107608273	missense	probably benign	0.30
R7293:Ptprq	UTSW	10	107635506	nonsense	probably null
R7445:Ptprq	UTSW	10	107590959	missense	probably damaging	1.00
R7632:Ptprq	UTSW	10	107711922	missense	probably benign	0.32
R7685:Ptprq	UTSW	10	107643978	missense	probably damaging	1.00
R7703:Ptprq	UTSW	10	107644146	missense	probably benign	0.01
R7774:Ptprq	UTSW	10	107643669	missense	probably damaging	0.96
R7897:Ptprq	UTSW	10	107710623	missense	probably benign	0.21
R7936:Ptprq	UTSW	10	107652711	missense	probably damaging	1.00
R7983:Ptprq	UTSW	10	107608411	nonsense	probably null
R8023:Ptprq	UTSW	10	107652616	nonsense	probably null
R8071:Ptprq	UTSW	10	107644035	missense	possibly damaging	0.62
R8084:Ptprq	UTSW	10	107608433	missense	probably benign
R8086:Ptprq	UTSW	10	107646639	nonsense	probably null
R8169:Ptprq	UTSW	10	107582490	missense	probably damaging	1.00
R8223:Ptprq	UTSW	10	107699638	missense	probably benign	0.00
R8235:Ptprq	UTSW	10	107582541	missense	probably damaging	1.00
R8235:Ptprq	UTSW	10	107705490	missense	probably benign	0.32
R8278:Ptprq	UTSW	10	107686378	missense	possibly damaging	0.87
Z1088:Ptprq	UTSW	10	107699672	missense	possibly damaging	0.56
Z1176:Ptprq	UTSW	10	107526070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTTACCGGAAGTGACGAAAGTGC -3'
(R):5'- TGCAATAAACGTGAGCTGGACGCC -3'

Sequencing Primer
(F):5'- AACTTAGGATTGCACCGTTTG -3'
(R):5'- AGCTGGACGCCACCATC -3'

Posted On

2014-04-13