Mutagenetix > Incidental Mutations

Incidental Mutation 'R1558:Mipol1'

170440

Institutional Source

Beutler Lab

Gene Symbol

Mipol1

Ensembl Gene

ENSMUSG00000047022

Gene Name

mirror-image polydactyly 1

Synonyms

1700081O04Rik, 6030439O22Rik, D12Ertd19e

MMRRC Submission

039597-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1558 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57230427-57497199 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57332341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 195 (I195T)

Ref Sequence

ENSEMBL: ENSMUSP00000117005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000123498
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: I195T

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128945

Predicted Effect

probably damaging
Transcript: ENSMUST00000130447
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: I195T

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000145003
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: I195T

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150292

Predicted Effect

probably damaging
Transcript: ENSMUST00000153137
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: I195T

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153439

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,065,705	I708F	probably benign	Het
4933406M09Rik	G	A	1: 134,390,774	G428D	probably damaging	Het
Abca1	T	A	4: 53,092,887	Q299L	probably null	Het
Adamts9	T	G	6: 92,908,711	K399N	possibly damaging	Het
Alox12b	T	C	11: 69,165,885	F369S	probably damaging	Het
Alpk2	A	G	18: 65,350,230	Y236H	probably benign	Het
Ankrd36	T	C	11: 5,635,329	L380P	probably damaging	Het
Atp2a1	C	T	7: 126,452,672	A468T	possibly damaging	Het
Caprin1	A	T	2: 103,775,987	F303I	possibly damaging	Het
Casp7	A	T	19: 56,433,252	R41*	probably null	Het
Ccdc66	T	A	14: 27,486,506	H753L	probably benign	Het
Ccnc	T	C	4: 21,742,671	M166T	probably benign	Het
Cdkl3	T	A	11: 52,032,510	M538K	possibly damaging	Het
Cercam	G	A	2: 29,876,239	A345T	probably benign	Het
Chmp3	T	A	6: 71,560,970	C60*	probably null	Het
Ddx1	C	T	12: 13,239,541	G125S	probably damaging	Het
Defb7	A	G	8: 19,497,551	D24G	probably benign	Het
Dgcr8	A	T	16: 18,259,588	Y653N	probably damaging	Het
Dsc2	T	C	18: 20,050,151	D70G	probably damaging	Het
Erich3	T	G	3: 154,714,068	N266K	probably damaging	Het
Fastk	A	T	5: 24,444,047		probably null	Het
Fat4	A	G	3: 38,888,986	N676S	probably damaging	Het
Fermt1	A	T	2: 132,934,819		probably null	Het
Fmn1	A	G	2: 113,693,118	T1149A	possibly damaging	Het
Foxo3	A	G	10: 42,197,072	V483A	probably damaging	Het
Fpgs	T	C	2: 32,685,840	T364A	possibly damaging	Het
Gm12185	A	G	11: 48,915,435	S310P	probably damaging	Het
Gm15056	A	T	8: 20,901,933		probably benign	Het
Hcn1	T	C	13: 117,975,576	V692A	unknown	Het
Izumo3	A	C	4: 92,146,903	C26G	probably damaging	Het
Kcnf1	T	C	12: 17,175,473	Y249C	probably damaging	Het
Kcnj6	T	C	16: 94,762,499	E380G	possibly damaging	Het
Kdm3b	A	G	18: 34,809,096	T747A	probably damaging	Het
Lrba	G	A	3: 86,351,315	G1370R	probably damaging	Het
Mei1	G	A	15: 82,107,133	R504Q	probably damaging	Het
Mum1	G	T	10: 80,232,944	R307S	probably benign	Het
Ncor2	G	A	5: 125,033,546	T1350I	probably damaging	Het
Npy	A	G	6: 49,823,725	E43G	probably damaging	Het
Olfr1152	T	A	2: 87,868,115	N41K	probably damaging	Het
Olfr1507	T	A	14: 52,490,146	I273F	probably benign	Het
Olfr924	T	A	9: 38,848,904	N263K	probably benign	Het
Pcdhb3	T	C	18: 37,301,581	L200P	probably damaging	Het
Pcnt	G	A	10: 76,422,922	H570Y	possibly damaging	Het
Pkd1l2	A	C	8: 117,082,252	D66E	possibly damaging	Het
Plekhg4	A	G	8: 105,381,835	D1170G	possibly damaging	Het
Poln	T	A	5: 34,032,799	H672L	probably benign	Het
Pqlc2	A	T	4: 139,300,080		probably benign	Het
Ptprq	T	C	10: 107,644,043	Y1122C	probably damaging	Het
Ptrhd1	A	G	12: 4,236,505	Y132C	probably damaging	Het
Riok1	G	T	13: 38,050,855	R300L	probably damaging	Het
Sbf2	G	T	7: 110,428,346	T481K	probably damaging	Het
Sidt2	A	T	9: 45,951,800	M11K	probably damaging	Het
Syne1	G	A	10: 5,349,280	R992*	probably null	Het
Tmem2	T	A	19: 21,797,982	Y196*	probably null	Het
Tmem8b	C	A	4: 43,681,134	R384S	possibly damaging	Het
Trim28	T	C	7: 13,027,834	Y243H	probably damaging	Het
Trpm6	T	C	19: 18,786,828	M266T	probably benign	Het
Tsg101	A	T	7: 46,889,689	S368T	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Ttc6	G	A	12: 57,686,346	V1092I	probably benign	Het
Vps13b	C	T	15: 35,534,319	T927I	probably damaging	Het
Zfr	C	T	15: 12,140,644	T259I	unknown	Het

Other mutations in Mipol1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Mipol1	APN	12	57307353	splice site	probably benign
IGL01139:Mipol1	APN	12	57306035	nonsense	probably null
IGL02679:Mipol1	APN	12	57306043	missense	possibly damaging	0.84
IGL03109:Mipol1	APN	12	57364224	missense	probably benign	0.20
R0001:Mipol1	UTSW	12	57460839	splice site	probably benign
R0220:Mipol1	UTSW	12	57457150	missense	probably damaging	1.00
R0271:Mipol1	UTSW	12	57460954	unclassified	probably benign
R0284:Mipol1	UTSW	12	57457069	missense	probably damaging	0.98
R0496:Mipol1	UTSW	12	57457177	missense	probably damaging	0.99
R0538:Mipol1	UTSW	12	57414411	critical splice donor site	probably null
R1082:Mipol1	UTSW	12	57325616	missense	probably damaging	0.98
R1552:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R1928:Mipol1	UTSW	12	57332419	missense	probably damaging	1.00
R2104:Mipol1	UTSW	12	57306056	splice site	probably null
R2495:Mipol1	UTSW	12	57460990	splice site	probably benign
R3723:Mipol1	UTSW	12	57457092	missense	probably damaging	1.00
R4431:Mipol1	UTSW	12	57303524	missense	possibly damaging	0.58
R4447:Mipol1	UTSW	12	57352748	intron	probably benign
R4654:Mipol1	UTSW	12	57306132	missense	probably benign	0.22
R4847:Mipol1	UTSW	12	57303496	missense	probably damaging	0.99
R4851:Mipol1	UTSW	12	57332301	missense	probably damaging	1.00
R5113:Mipol1	UTSW	12	57496499	missense	probably benign	0.36
R5668:Mipol1	UTSW	12	57325560	missense	possibly damaging	0.48
R6535:Mipol1	UTSW	12	57306100	missense	possibly damaging	0.95
R7172:Mipol1	UTSW	12	57325535	missense	possibly damaging	0.95
R7191:Mipol1	UTSW	12	57457066	missense	probably benign	0.01
R7560:Mipol1	UTSW	12	57306073	missense	possibly damaging	0.94
R8508:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R8752:Mipol1	UTSW	12	57325581	missense	probably damaging	1.00
R8772:Mipol1	UTSW	12	57325632	missense	probably benign	0.23
R8861:Mipol1	UTSW	12	57306016	missense	probably benign	0.00
R8928:Mipol1	UTSW	12	57460865	missense	probably benign	0.00
R9011:Mipol1	UTSW	12	57457079	missense	probably benign	0.03
R9250:Mipol1	UTSW	12	57414383	missense	probably damaging	1.00
R9383:Mipol1	UTSW	12	57306034	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTTGCCGCACTAAAGAAATGCTACTG -3'
(R):5'- GCATGAACTGTCACAAGGAAATGCAC -3'

Sequencing Primer
(F):5'- GACATGGTAAGCCATTCTCTGAG -3'
(R):5'- GTGCAAAATTCACTGTTTCGG -3'

Posted On

2014-04-13