Incidental Mutation 'R1558:Mipol1'
ID 170440
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1558 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57332341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 195 (I195T)
Ref Sequence ENSEMBL: ENSMUSP00000117005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000123498
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: I195T

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128945
Predicted Effect probably damaging
Transcript: ENSMUST00000130447
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: I195T

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000145003
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: I195T

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150292
Predicted Effect probably damaging
Transcript: ENSMUST00000153137
AA Change: I195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: I195T

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153439
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTGCCGCACTAAAGAAATGCTACTG -3'
(R):5'- GCATGAACTGTCACAAGGAAATGCAC -3'

Sequencing Primer
(F):5'- GACATGGTAAGCCATTCTCTGAG -3'
(R):5'- GTGCAAAATTCACTGTTTCGG -3'
Posted On 2014-04-13