Mutagenetix > Incidental Mutations

Incidental Mutation 'R1558:Hcn1'

170443

Institutional Source

Beutler Lab

Gene Symbol

Hcn1

Ensembl Gene

ENSMUSG00000021730

Gene Name

hyperpolarization-activated, cyclic nucleotide-gated K+ 1

Synonyms

HAC2, Bcng1, C630013B14Rik

MMRRC Submission

039597-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1558 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117602320-117987418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117975576 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 692 (V692A)

Ref Sequence

ENSEMBL: ENSMUSP00000006991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006991]

PDB Structure

Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]

Predicted Effect

unknown
Transcript: ENSMUST00000006991
AA Change: V692A

SMART Domains

Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: V692A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans_N	87	130	8.2e-24	PFAM
Pfam:Ion_trans	131	394	2.1e-23	PFAM
low complexity region	395	406	N/A	INTRINSIC
Blast:cNMP	407	439	4e-13	BLAST
cNMP	464	580	1.95e-22	SMART
low complexity region	639	655	N/A	INTRINSIC
low complexity region	660	680	N/A	INTRINSIC
low complexity region	720	779	N/A	INTRINSIC
low complexity region	878	886	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,065,705	I708F	probably benign	Het
4933406M09Rik	G	A	1: 134,390,774	G428D	probably damaging	Het
Abca1	T	A	4: 53,092,887	Q299L	probably null	Het
Adamts9	T	G	6: 92,908,711	K399N	possibly damaging	Het
Alox12b	T	C	11: 69,165,885	F369S	probably damaging	Het
Alpk2	A	G	18: 65,350,230	Y236H	probably benign	Het
Ankrd36	T	C	11: 5,635,329	L380P	probably damaging	Het
Atp2a1	C	T	7: 126,452,672	A468T	possibly damaging	Het
Caprin1	A	T	2: 103,775,987	F303I	possibly damaging	Het
Casp7	A	T	19: 56,433,252	R41*	probably null	Het
Ccdc66	T	A	14: 27,486,506	H753L	probably benign	Het
Ccnc	T	C	4: 21,742,671	M166T	probably benign	Het
Cdkl3	T	A	11: 52,032,510	M538K	possibly damaging	Het
Cercam	G	A	2: 29,876,239	A345T	probably benign	Het
Chmp3	T	A	6: 71,560,970	C60*	probably null	Het
Ddx1	C	T	12: 13,239,541	G125S	probably damaging	Het
Defb7	A	G	8: 19,497,551	D24G	probably benign	Het
Dgcr8	A	T	16: 18,259,588	Y653N	probably damaging	Het
Dsc2	T	C	18: 20,050,151	D70G	probably damaging	Het
Erich3	T	G	3: 154,714,068	N266K	probably damaging	Het
Fastk	A	T	5: 24,444,047		probably null	Het
Fat4	A	G	3: 38,888,986	N676S	probably damaging	Het
Fermt1	A	T	2: 132,934,819		probably null	Het
Fmn1	A	G	2: 113,693,118	T1149A	possibly damaging	Het
Foxo3	A	G	10: 42,197,072	V483A	probably damaging	Het
Fpgs	T	C	2: 32,685,840	T364A	possibly damaging	Het
Gm12185	A	G	11: 48,915,435	S310P	probably damaging	Het
Gm15056	A	T	8: 20,901,933		probably benign	Het
Izumo3	A	C	4: 92,146,903	C26G	probably damaging	Het
Kcnf1	T	C	12: 17,175,473	Y249C	probably damaging	Het
Kcnj6	T	C	16: 94,762,499	E380G	possibly damaging	Het
Kdm3b	A	G	18: 34,809,096	T747A	probably damaging	Het
Lrba	G	A	3: 86,351,315	G1370R	probably damaging	Het
Mei1	G	A	15: 82,107,133	R504Q	probably damaging	Het
Mipol1	T	C	12: 57,332,341	I195T	probably damaging	Het
Mum1	G	T	10: 80,232,944	R307S	probably benign	Het
Ncor2	G	A	5: 125,033,546	T1350I	probably damaging	Het
Npy	A	G	6: 49,823,725	E43G	probably damaging	Het
Olfr1152	T	A	2: 87,868,115	N41K	probably damaging	Het
Olfr1507	T	A	14: 52,490,146	I273F	probably benign	Het
Olfr924	T	A	9: 38,848,904	N263K	probably benign	Het
Pcdhb3	T	C	18: 37,301,581	L200P	probably damaging	Het
Pcnt	G	A	10: 76,422,922	H570Y	possibly damaging	Het
Pkd1l2	A	C	8: 117,082,252	D66E	possibly damaging	Het
Plekhg4	A	G	8: 105,381,835	D1170G	possibly damaging	Het
Poln	T	A	5: 34,032,799	H672L	probably benign	Het
Pqlc2	A	T	4: 139,300,080		probably benign	Het
Ptprq	T	C	10: 107,644,043	Y1122C	probably damaging	Het
Ptrhd1	A	G	12: 4,236,505	Y132C	probably damaging	Het
Riok1	G	T	13: 38,050,855	R300L	probably damaging	Het
Sbf2	G	T	7: 110,428,346	T481K	probably damaging	Het
Sidt2	A	T	9: 45,951,800	M11K	probably damaging	Het
Syne1	G	A	10: 5,349,280	R992*	probably null	Het
Tmem2	T	A	19: 21,797,982	Y196*	probably null	Het
Tmem8b	C	A	4: 43,681,134	R384S	possibly damaging	Het
Trim28	T	C	7: 13,027,834	Y243H	probably damaging	Het
Trpm6	T	C	19: 18,786,828	M266T	probably benign	Het
Tsg101	A	T	7: 46,889,689	S368T	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Ttc6	G	A	12: 57,686,346	V1092I	probably benign	Het
Vps13b	C	T	15: 35,534,319	T927I	probably damaging	Het
Zfr	C	T	15: 12,140,644	T259I	unknown	Het

Other mutations in Hcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Hcn1	APN	13	117975993	missense	probably damaging	1.00
IGL00340:Hcn1	APN	13	117602977	missense	unknown
IGL01161:Hcn1	APN	13	117656922	missense	unknown
IGL01723:Hcn1	APN	13	117976055	missense	probably damaging	0.98
IGL02324:Hcn1	APN	13	117902886	missense	unknown
IGL02491:Hcn1	APN	13	117810040	missense	unknown
Thump	UTSW	13	117873905	nonsense	probably null
FR4976:Hcn1	UTSW	13	117975808	small insertion	probably benign
PIT4504001:Hcn1	UTSW	13	117975875	missense	possibly damaging	0.90
R0420:Hcn1	UTSW	13	117975375	missense	unknown
R1546:Hcn1	UTSW	13	117975766	small insertion	probably benign
R1659:Hcn1	UTSW	13	117976074	missense	probably damaging	0.99
R1667:Hcn1	UTSW	13	117603073	missense	unknown
R1766:Hcn1	UTSW	13	117656734	missense	probably benign	0.39
R1842:Hcn1	UTSW	13	117976008	missense	probably damaging	0.99
R2051:Hcn1	UTSW	13	117976083	missense	probably damaging	0.99
R3605:Hcn1	UTSW	13	117975252	missense	unknown
R4259:Hcn1	UTSW	13	117975348	missense	unknown
R4284:Hcn1	UTSW	13	117975733	small deletion	probably benign
R4637:Hcn1	UTSW	13	117975713	missense	unknown
R4679:Hcn1	UTSW	13	117657015	missense	probably benign	0.39
R4777:Hcn1	UTSW	13	117975733	small deletion	probably benign
R4839:Hcn1	UTSW	13	117925710	missense	unknown
R4883:Hcn1	UTSW	13	117902895	critical splice donor site	probably null
R5015:Hcn1	UTSW	13	117603020	missense	unknown
R5060:Hcn1	UTSW	13	117873905	nonsense	probably null
R5748:Hcn1	UTSW	13	117976055	missense	probably damaging	0.99
R5823:Hcn1	UTSW	13	117602852	missense	unknown
R6900:Hcn1	UTSW	13	117656827	missense	probably benign	0.39
R7045:Hcn1	UTSW	13	117975462	missense	unknown
R7049:Hcn1	UTSW	13	117975462	missense	unknown
R7163:Hcn1	UTSW	13	117925547	missense	unknown
R7534:Hcn1	UTSW	13	117975425	missense	unknown
R7722:Hcn1	UTSW	13	117902778	missense	unknown
R7984:Hcn1	UTSW	13	117976073	nonsense	probably null
R8083:Hcn1	UTSW	13	117975760	small insertion	probably benign
R8171:Hcn1	UTSW	13	117602734	missense	unknown
R8223:Hcn1	UTSW	13	117873870	missense	unknown
R8240:Hcn1	UTSW	13	117975733	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCGAGAGATGGTACAAGCTATCCC -3'
(R):5'- AAGGTGACACGTTGTGGCACTG -3'

Sequencing Primer
(F):5'- GATGGTACAAGCTATCCCTCCAATC -3'
(R):5'- ctgctgctgctgttgttg -3'

Posted On

2014-04-13