Mutagenetix > Incidental Mutations

Incidental Mutation 'R1558:Dsc2'

170454

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

039597-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1558 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20050151 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 70 (D70G)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: D70G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: D70G

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: D70G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: D70G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000128464
AA Change: D70G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: D70G

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,065,705	I708F	probably benign	Het
4933406M09Rik	G	A	1: 134,390,774	G428D	probably damaging	Het
Abca1	T	A	4: 53,092,887	Q299L	probably null	Het
Adamts9	T	G	6: 92,908,711	K399N	possibly damaging	Het
Alox12b	T	C	11: 69,165,885	F369S	probably damaging	Het
Alpk2	A	G	18: 65,350,230	Y236H	probably benign	Het
Ankrd36	T	C	11: 5,635,329	L380P	probably damaging	Het
Atp2a1	C	T	7: 126,452,672	A468T	possibly damaging	Het
Caprin1	A	T	2: 103,775,987	F303I	possibly damaging	Het
Casp7	A	T	19: 56,433,252	R41*	probably null	Het
Ccdc66	T	A	14: 27,486,506	H753L	probably benign	Het
Ccnc	T	C	4: 21,742,671	M166T	probably benign	Het
Cdkl3	T	A	11: 52,032,510	M538K	possibly damaging	Het
Cercam	G	A	2: 29,876,239	A345T	probably benign	Het
Chmp3	T	A	6: 71,560,970	C60*	probably null	Het
Ddx1	C	T	12: 13,239,541	G125S	probably damaging	Het
Defb7	A	G	8: 19,497,551	D24G	probably benign	Het
Dgcr8	A	T	16: 18,259,588	Y653N	probably damaging	Het
Erich3	T	G	3: 154,714,068	N266K	probably damaging	Het
Fastk	A	T	5: 24,444,047		probably null	Het
Fat4	A	G	3: 38,888,986	N676S	probably damaging	Het
Fermt1	A	T	2: 132,934,819		probably null	Het
Fmn1	A	G	2: 113,693,118	T1149A	possibly damaging	Het
Foxo3	A	G	10: 42,197,072	V483A	probably damaging	Het
Fpgs	T	C	2: 32,685,840	T364A	possibly damaging	Het
Gm12185	A	G	11: 48,915,435	S310P	probably damaging	Het
Gm15056	A	T	8: 20,901,933		probably benign	Het
Hcn1	T	C	13: 117,975,576	V692A	unknown	Het
Izumo3	A	C	4: 92,146,903	C26G	probably damaging	Het
Kcnf1	T	C	12: 17,175,473	Y249C	probably damaging	Het
Kcnj6	T	C	16: 94,762,499	E380G	possibly damaging	Het
Kdm3b	A	G	18: 34,809,096	T747A	probably damaging	Het
Lrba	G	A	3: 86,351,315	G1370R	probably damaging	Het
Mei1	G	A	15: 82,107,133	R504Q	probably damaging	Het
Mipol1	T	C	12: 57,332,341	I195T	probably damaging	Het
Mum1	G	T	10: 80,232,944	R307S	probably benign	Het
Ncor2	G	A	5: 125,033,546	T1350I	probably damaging	Het
Npy	A	G	6: 49,823,725	E43G	probably damaging	Het
Olfr1152	T	A	2: 87,868,115	N41K	probably damaging	Het
Olfr1507	T	A	14: 52,490,146	I273F	probably benign	Het
Olfr924	T	A	9: 38,848,904	N263K	probably benign	Het
Pcdhb3	T	C	18: 37,301,581	L200P	probably damaging	Het
Pcnt	G	A	10: 76,422,922	H570Y	possibly damaging	Het
Pkd1l2	A	C	8: 117,082,252	D66E	possibly damaging	Het
Plekhg4	A	G	8: 105,381,835	D1170G	possibly damaging	Het
Poln	T	A	5: 34,032,799	H672L	probably benign	Het
Pqlc2	A	T	4: 139,300,080		probably benign	Het
Ptprq	T	C	10: 107,644,043	Y1122C	probably damaging	Het
Ptrhd1	A	G	12: 4,236,505	Y132C	probably damaging	Het
Riok1	G	T	13: 38,050,855	R300L	probably damaging	Het
Sbf2	G	T	7: 110,428,346	T481K	probably damaging	Het
Sidt2	A	T	9: 45,951,800	M11K	probably damaging	Het
Syne1	G	A	10: 5,349,280	R992*	probably null	Het
Tmem2	T	A	19: 21,797,982	Y196*	probably null	Het
Tmem8b	C	A	4: 43,681,134	R384S	possibly damaging	Het
Trim28	T	C	7: 13,027,834	Y243H	probably damaging	Het
Trpm6	T	C	19: 18,786,828	M266T	probably benign	Het
Tsg101	A	T	7: 46,889,689	S368T	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Ttc6	G	A	12: 57,686,346	V1092I	probably benign	Het
Vps13b	C	T	15: 35,534,319	T927I	probably damaging	Het
Zfr	C	T	15: 12,140,644	T259I	unknown	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAAGCACCATTGACCCTGGCTCTC -3'
(R):5'- TCACTGGCCGATCAATTCCTTATGTG -3'

Sequencing Primer
(F):5'- GTCAGTGTCAGTTAGCCCTAAAG -3'
(R):5'- AAGTAGTGTGCCGTCTCTAATAGC -3'

Posted On

2014-04-13