Incidental Mutation 'R1558:Kdm3b'
ID170455
Institutional Source Beutler Lab
Gene Symbol Kdm3b
Ensembl Gene ENSMUSG00000038773
Gene NameKDM3B lysine (K)-specific demethylase 3B
SynonymsJHDM2B, Jmjd1b, 5830462I21Rik
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34777047-34838660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34809096 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 747 (T747A)
Ref Sequence ENSEMBL: ENSMUSP00000037628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043775] [ENSMUST00000224715] [ENSMUST00000225195]
Predicted Effect probably damaging
Transcript: ENSMUST00000043775
AA Change: T747A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773
AA Change: T747A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224065
Predicted Effect probably benign
Transcript: ENSMUST00000224715
Predicted Effect probably damaging
Transcript: ENSMUST00000225195
AA Change: T547A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Kdm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kdm3b APN 18 34809409 missense probably benign 0.03
IGL01357:Kdm3b APN 18 34793014 missense probably damaging 1.00
IGL01615:Kdm3b APN 18 34829231 missense probably damaging 1.00
IGL01980:Kdm3b APN 18 34834236 missense probably damaging 1.00
IGL02277:Kdm3b APN 18 34823664 missense probably damaging 1.00
IGL02346:Kdm3b APN 18 34834238 missense probably damaging 1.00
IGL02417:Kdm3b APN 18 34808577 missense probably benign 0.03
IGL02531:Kdm3b APN 18 34795729 missense probably benign
IGL02589:Kdm3b APN 18 34812418 missense possibly damaging 0.89
IGL02793:Kdm3b APN 18 34829019 missense probably damaging 0.99
IGL03121:Kdm3b APN 18 34795709 missense probably damaging 0.98
IGL03123:Kdm3b APN 18 34809491 critical splice donor site probably null
IGL03128:Kdm3b APN 18 34827427 missense probably damaging 1.00
PIT4382001:Kdm3b UTSW 18 34809087 missense probably damaging 1.00
PIT4445001:Kdm3b UTSW 18 34793115 nonsense probably null
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0233:Kdm3b UTSW 18 34809420 missense probably damaging 0.97
R0265:Kdm3b UTSW 18 34795663 splice site probably benign
R0306:Kdm3b UTSW 18 34804017 missense probably benign 0.35
R0941:Kdm3b UTSW 18 34803552 missense probably damaging 0.99
R0970:Kdm3b UTSW 18 34809039 missense probably damaging 1.00
R1061:Kdm3b UTSW 18 34796862 missense probably damaging 1.00
R1104:Kdm3b UTSW 18 34819811 missense probably damaging 1.00
R1221:Kdm3b UTSW 18 34808245 missense possibly damaging 0.57
R1486:Kdm3b UTSW 18 34834304 missense probably damaging 1.00
R1523:Kdm3b UTSW 18 34793173 critical splice donor site probably null
R1585:Kdm3b UTSW 18 34809292 missense probably damaging 1.00
R1601:Kdm3b UTSW 18 34808731 missense probably damaging 1.00
R1650:Kdm3b UTSW 18 34809115 missense possibly damaging 0.93
R1772:Kdm3b UTSW 18 34803504 missense probably benign 0.01
R1853:Kdm3b UTSW 18 34833393 missense probably damaging 1.00
R1934:Kdm3b UTSW 18 34813544 missense probably benign 0.04
R1959:Kdm3b UTSW 18 34812395 missense possibly damaging 0.55
R2079:Kdm3b UTSW 18 34803517 missense probably damaging 1.00
R2102:Kdm3b UTSW 18 34830147 missense probably damaging 1.00
R2121:Kdm3b UTSW 18 34796780 splice site probably benign
R2281:Kdm3b UTSW 18 34808419 missense probably damaging 1.00
R3719:Kdm3b UTSW 18 34808671 missense probably damaging 1.00
R3755:Kdm3b UTSW 18 34808296 missense probably benign
R3857:Kdm3b UTSW 18 34833387 missense probably benign
R4165:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4166:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4372:Kdm3b UTSW 18 34827444 missense probably benign 0.00
R4672:Kdm3b UTSW 18 34808577 missense probably benign
R4933:Kdm3b UTSW 18 34810393 missense probably damaging 1.00
R4969:Kdm3b UTSW 18 34822375 missense probably damaging 1.00
R5009:Kdm3b UTSW 18 34824710 missense probably benign 0.42
R5059:Kdm3b UTSW 18 34777197 missense possibly damaging 0.83
R5092:Kdm3b UTSW 18 34813462 missense probably benign 0.16
R5270:Kdm3b UTSW 18 34827414 missense probably damaging 1.00
R5816:Kdm3b UTSW 18 34828469 missense probably damaging 0.99
R5970:Kdm3b UTSW 18 34829289 missense probably damaging 1.00
R6244:Kdm3b UTSW 18 34793005 missense probably damaging 1.00
R6705:Kdm3b UTSW 18 34819873 missense probably damaging 1.00
R6723:Kdm3b UTSW 18 34793005 missense probably damaging 0.99
R6909:Kdm3b UTSW 18 34827328 splice site probably null
R6958:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R7026:Kdm3b UTSW 18 34822464 missense possibly damaging 0.90
R7289:Kdm3b UTSW 18 34794504 missense probably benign 0.00
R7488:Kdm3b UTSW 18 34824881 missense probably damaging 0.97
R7695:Kdm3b UTSW 18 34794559 missense possibly damaging 0.86
X0028:Kdm3b UTSW 18 34799266 intron probably null
X0067:Kdm3b UTSW 18 34823517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGCATCAGGTAGCTCTTCCTC -3'
(R):5'- TGCAAGCCAAGCTTCGCTCATC -3'

Sequencing Primer
(F):5'- GCAGAGTCTGCACCTTTAGC -3'
(R):5'- GCTTCGCTCATCCAATGAGAAC -3'
Posted On2014-04-13