Incidental Mutation 'R1558:Pcdhb3'
ID170456
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Nameprotocadherin beta 3
SynonymsPcdhbC
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37300799-37304585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37301581 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 200 (L200P)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000051754
AA Change: L200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: L200P

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37302948 missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37302001 missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37302145 missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37302097 missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37301219 missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37302961 missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37302157 missense possibly damaging 0.48
R1713:Pcdhb3 UTSW 18 37303322 missense probably benign
R1728:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37301317 missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37303309 missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37302186 missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37301239 nonsense probably null
R2513:Pcdhb3 UTSW 18 37301240 missense probably damaging 1.00
R2513:Pcdhb3 UTSW 18 37301241 missense probably benign 0.17
R3080:Pcdhb3 UTSW 18 37301482 missense probably damaging 1.00
R3755:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3756:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37302040 missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37301706 missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37302399 missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37301126 missense probably damaging 1.00
R5779:Pcdhb3 UTSW 18 37301467 missense probably benign 0.26
R5848:Pcdhb3 UTSW 18 37301647 missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37301508 missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37302653 missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37302189 missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37301646 missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37300945 intron probably benign
R6425:Pcdhb3 UTSW 18 37302475 missense possibly damaging 0.64
R6860:Pcdhb3 UTSW 18 37301710 missense probably benign 0.01
R6896:Pcdhb3 UTSW 18 37301212 missense probably damaging 1.00
R6946:Pcdhb3 UTSW 18 37302619 missense probably damaging 1.00
R7110:Pcdhb3 UTSW 18 37302922 missense possibly damaging 0.87
R7236:Pcdhb3 UTSW 18 37301452 missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37301604 missense probably benign
R7469:Pcdhb3 UTSW 18 37301335 missense probably benign 0.02
R7723:Pcdhb3 UTSW 18 37302512 missense probably damaging 0.98
R7738:Pcdhb3 UTSW 18 37302959 missense probably benign 0.00
R7800:Pcdhb3 UTSW 18 37301921 missense probably benign 0.00
R7817:Pcdhb3 UTSW 18 37302929 missense probably benign
X0026:Pcdhb3 UTSW 18 37301764 missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37302339 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAAAGTCCTGGAAAACTCCGTG -3'
(R):5'- TTCCCGTATCCAAGTCAGAGGCAG -3'

Sequencing Primer
(F):5'- CGTGCCTGGGACAGTAATTC -3'
(R):5'- TGACAGAGCCAATAGGGCTTTTC -3'
Posted On2014-04-13