Incidental Mutation 'R1559:Lrrc4c'
ID170475
Institutional Source Beutler Lab
Gene Symbol Lrrc4c
Ensembl Gene ENSMUSG00000050587
Gene Nameleucine rich repeat containing 4C
Synonymsnetrin g1 ligand, 6430556C10Rik
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1559 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location96318169-97631666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97630772 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 581 (M581K)
Ref Sequence ENSEMBL: ENSMUSP00000125218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059049] [ENSMUST00000135431] [ENSMUST00000162807] [ENSMUST00000170144]
Predicted Effect probably benign
Transcript: ENSMUST00000059049
AA Change: M581K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000131795
Gene: ENSMUSG00000050587
AA Change: M581K

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135431
AA Change: M581K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000130984
Gene: ENSMUSG00000050587
AA Change: M581K

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162807
AA Change: M581K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125218
Gene: ENSMUSG00000050587
AA Change: M581K

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199276
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NGL1 is a specific binding partner for netrin G1 (NTNG1; MIM 608818), which is a member of the netrin family of axon guidance molecules (Lin et al., 2003 [PubMed 14595443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice exhibited an increased mean serum IL-6 response to LPS challenge when compared with controls. No other notable phenotype was detected in a high-througput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Daam2 A G 17: 49,496,120 probably benign Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Heyl A G 4: 123,241,399 S62G probably damaging Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il12rb2 G T 6: 67,356,592 F234L probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
M6pr A T 6: 122,315,074 I122L probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Olfr937 T C 9: 39,060,141 N175S probably benign Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Slco6c1 T A 1: 97,098,498 D334V probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Stk32a C A 18: 43,243,084 Q73K probably benign Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in Lrrc4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Lrrc4c APN 2 97630385 nonsense probably null
IGL02095:Lrrc4c APN 2 97629404 missense probably benign 0.05
IGL02165:Lrrc4c APN 2 97629033 start codon destroyed probably null 0.33
IGL02176:Lrrc4c APN 2 97630253 missense probably damaging 0.96
IGL02674:Lrrc4c APN 2 97629775 missense probably damaging 0.99
IGL03082:Lrrc4c APN 2 97630586 missense probably benign 0.05
IGL03303:Lrrc4c APN 2 97629592 missense probably damaging 1.00
R0946:Lrrc4c UTSW 2 97629464 missense probably benign 0.00
R1037:Lrrc4c UTSW 2 97629985 missense probably benign
R1518:Lrrc4c UTSW 2 97630576 missense probably benign
R2192:Lrrc4c UTSW 2 97629312 missense possibly damaging 0.50
R2213:Lrrc4c UTSW 2 97630471 missense probably benign 0.29
R2279:Lrrc4c UTSW 2 97630505 missense possibly damaging 0.86
R3552:Lrrc4c UTSW 2 97629961 missense probably damaging 1.00
R3840:Lrrc4c UTSW 2 97630192 missense probably damaging 0.98
R3841:Lrrc4c UTSW 2 97630192 missense probably damaging 0.98
R4606:Lrrc4c UTSW 2 97630313 missense probably benign 0.22
R4938:Lrrc4c UTSW 2 97629301 missense probably damaging 1.00
R4946:Lrrc4c UTSW 2 97630489 missense probably benign 0.00
R5323:Lrrc4c UTSW 2 97630153 missense probably damaging 1.00
R6014:Lrrc4c UTSW 2 97629212 unclassified probably null
R6297:Lrrc4c UTSW 2 97629619 missense probably damaging 0.99
R6376:Lrrc4c UTSW 2 97629046 missense probably benign 0.03
R7032:Lrrc4c UTSW 2 97629065 missense probably benign
R7419:Lrrc4c UTSW 2 97629761 missense probably benign 0.07
R7699:Lrrc4c UTSW 2 97630679 missense possibly damaging 0.81
R7700:Lrrc4c UTSW 2 97630679 missense possibly damaging 0.81
R7723:Lrrc4c UTSW 2 97630654 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACAGCGGAATCCCAGGAATTGATG -3'
(R):5'- AGACTGGATCTCACCACTAGAATTCACC -3'

Sequencing Primer
(F):5'- ATCCCAGGAATTGATGAGGTC -3'
(R):5'- atttagcccagtcatttgtgtc -3'
Posted On2014-04-13