Incidental Mutation 'R1559:Heyl'
ID170482
Institutional Source Beutler Lab
Gene Symbol Heyl
Ensembl Gene ENSMUSG00000032744
Gene Namehairy/enhancer-of-split related with YRPW motif-like
SynonymsHrt3, bHLHb33, Hey3, Hesr3
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1559 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123233556-123249875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123241399 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 62 (S62G)
Ref Sequence ENSEMBL: ENSMUSP00000040576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040821]
Predicted Effect probably damaging
Transcript: ENSMUST00000040821
AA Change: S62G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040576
Gene: ENSMUSG00000032744
AA Change: S62G

DomainStartEndE-ValueType
HLH 49 104 8.72e-15 SMART
ORANGE 114 162 1.72e-14 SMART
low complexity region 205 215 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151870
Meta Mutation Damage Score 0.6954 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The sequence of the encoded protein contains a conserved bHLH and orange domain, but its YRPW motif has diverged from other HESR family members. It is thought to be an effector of Notch signaling and a regulator of cell fate decisions. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced TrkC+ sensory neurons in the dorsal root ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Daam2 A G 17: 49,496,120 probably benign Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il12rb2 G T 6: 67,356,592 F234L probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
Lrrc4c T A 2: 97,630,772 M581K probably benign Het
M6pr A T 6: 122,315,074 I122L probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Olfr937 T C 9: 39,060,141 N175S probably benign Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Slco6c1 T A 1: 97,098,498 D334V probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Stk32a C A 18: 43,243,084 Q73K probably benign Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in Heyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Heyl APN 4 123246630 makesense probably null
IGL01420:Heyl APN 4 123240174 missense probably damaging 1.00
IGL01897:Heyl APN 4 123246607 missense probably damaging 0.99
IGL02130:Heyl APN 4 123246271 missense probably benign 0.00
R0347:Heyl UTSW 4 123233940 missense probably benign 0.27
R0661:Heyl UTSW 4 123246031 missense probably damaging 1.00
R1840:Heyl UTSW 4 123241390 missense probably damaging 1.00
R2044:Heyl UTSW 4 123241363 missense probably damaging 1.00
R2132:Heyl UTSW 4 123246083 missense probably damaging 1.00
R7151:Heyl UTSW 4 123246461 missense probably benign 0.00
Z1088:Heyl UTSW 4 123240181 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACTGCTAAGGCTGCATATCCCTG -3'
(R):5'- actgctggatcatctCTCTAGCCC -3'

Sequencing Primer
(F):5'- tgtcagtcttaactttcattcttgtc -3'
(R):5'- ctttccttccataatgtgagacc -3'
Posted On2014-04-13