Incidental Mutation 'R1559:Il12rb2'
ID170488
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Nameinterleukin 12 receptor, beta 2
SynonymsIL-12RB2, Ifnm, A930027I18Rik
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1559 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67291318-67376188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67356592 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 234 (F234L)
Ref Sequence ENSEMBL: ENSMUSP00000010605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485]
Predicted Effect probably benign
Transcript: ENSMUST00000018485
AA Change: F234L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: F234L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Daam2 A G 17: 49,496,120 probably benign Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Heyl A G 4: 123,241,399 S62G probably damaging Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
Lrrc4c T A 2: 97,630,772 M581K probably benign Het
M6pr A T 6: 122,315,074 I122L probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Olfr937 T C 9: 39,060,141 N175S probably benign Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Slco6c1 T A 1: 97,098,498 D334V probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Stk32a C A 18: 43,243,084 Q73K probably benign Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67357692 missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67303562 missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67360567 missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67336754 missense probably benign
IGL00965:Il12rb2 APN 6 67360577 missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67361865 splice site probably benign
IGL01980:Il12rb2 APN 6 67360535 missense probably benign
IGL02246:Il12rb2 APN 6 67308956 critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67351316 missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67316286 missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0079:Il12rb2 UTSW 6 67361905 missense probably benign 0.00
R0462:Il12rb2 UTSW 6 67303610 missense possibly damaging 0.95
R0709:Il12rb2 UTSW 6 67298904 splice site probably benign
R0828:Il12rb2 UTSW 6 67356707 missense probably benign
R1051:Il12rb2 UTSW 6 67356735 missense probably benign
R1191:Il12rb2 UTSW 6 67298216 missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67309143 missense probably benign
R1677:Il12rb2 UTSW 6 67303501 missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67336760 missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67295286 nonsense probably null
R1952:Il12rb2 UTSW 6 67292316 missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67360545 missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67360552 missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67361944 nonsense probably null
R2358:Il12rb2 UTSW 6 67298195 missense probably damaging 0.96
R2680:Il12rb2 UTSW 6 67354805 missense possibly damaging 0.94
R2920:Il12rb2 UTSW 6 67360568 missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67360798 missense probably damaging 1.00
R4420:Il12rb2 UTSW 6 67316410 splice site probably null
R4838:Il12rb2 UTSW 6 67309137 missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67292420 missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67292262 missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67295278 missense possibly damaging 0.94
R5704:Il12rb2 UTSW 6 67292213 missense possibly damaging 0.53
R5891:Il12rb2 UTSW 6 67360690 missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67356686 missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67361966 start gained probably benign
R6813:Il12rb2 UTSW 6 67292374 missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67292652 missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67356633 missense probably benign 0.29
R7361:Il12rb2 UTSW 6 67303466 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCTGAAAGTCCCATTTGGTTGCAC -3'
(R):5'- GACCAGCCTTAAACCGTCTGTCTG -3'

Sequencing Primer
(F):5'- tgcacttctatgcggctac -3'
(R):5'- GTTAAGTGGACCAAACAATCTGAC -3'
Posted On2014-04-13