Incidental Mutation 'R1559:Olfr937'
ID170504
Institutional Source Beutler Lab
Gene Symbol Olfr937
Ensembl Gene ENSMUSG00000094182
Gene Nameolfactory receptor 937
SynonymsMOR171-24, GA_x6K02T2PVTD-32756567-32755632
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1559 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39058851-39064951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39060141 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 175 (N175S)
Ref Sequence ENSEMBL: ENSMUSP00000150274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055567] [ENSMUST00000215049]
Predicted Effect probably benign
Transcript: ENSMUST00000055567
AA Change: N175S

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058346
Gene: ENSMUSG00000094182
AA Change: N175S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215049
AA Change: N175S

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1473 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Daam2 A G 17: 49,496,120 probably benign Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Heyl A G 4: 123,241,399 S62G probably damaging Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il12rb2 G T 6: 67,356,592 F234L probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
Lrrc4c T A 2: 97,630,772 M581K probably benign Het
M6pr A T 6: 122,315,074 I122L probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Slco6c1 T A 1: 97,098,498 D334V probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Stk32a C A 18: 43,243,084 Q73K probably benign Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in Olfr937
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr937 APN 9 39059863 missense probably benign 0.03
IGL01387:Olfr937 APN 9 39060321 missense probably damaging 1.00
IGL01775:Olfr937 APN 9 39060467 missense probably damaging 1.00
IGL02076:Olfr937 APN 9 39060585 missense probably damaging 1.00
IGL02740:Olfr937 APN 9 39060289 missense probably benign 0.22
IGL03115:Olfr937 APN 9 39059963 missense probably damaging 0.99
R0121:Olfr937 UTSW 9 39059760 missense probably damaging 1.00
R0908:Olfr937 UTSW 9 39059947 missense probably damaging 1.00
R2006:Olfr937 UTSW 9 39060433 missense probably damaging 0.99
R2010:Olfr937 UTSW 9 39060099 missense probably benign 0.05
R2191:Olfr937 UTSW 9 39060405 missense probably benign
R3874:Olfr937 UTSW 9 39060174 missense probably benign 0.00
R4970:Olfr937 UTSW 9 39060531 missense probably benign 0.12
R5217:Olfr937 UTSW 9 39059769 missense probably benign 0.00
R5836:Olfr937 UTSW 9 39060622 missense probably benign
R5886:Olfr937 UTSW 9 39060382 missense probably benign 0.00
R6109:Olfr937 UTSW 9 39060196 missense probably benign 0.23
R7261:Olfr937 UTSW 9 39060208 missense possibly damaging 0.64
R7328:Olfr937 UTSW 9 39060561 missense probably damaging 1.00
R7345:Olfr937 UTSW 9 39060579 missense probably damaging 1.00
R7419:Olfr937 UTSW 9 39060169 missense probably benign 0.00
X0022:Olfr937 UTSW 9 39060417 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAACACAGAGGACACTTTCCCTTGG -3'
(R):5'- GTTAGCTGCAATGGCATATGATCGC -3'

Sequencing Primer
(F):5'- GTACATGAATGCAGCAGACC -3'
(R):5'- GCATATGATCGCTATGTTGCC -3'
Posted On2014-04-13