Incidental Mutation 'R1559:Daam2'
ID170520
Institutional Source Beutler Lab
Gene Symbol Daam2
Ensembl Gene ENSMUSG00000040260
Gene Namedishevelled associated activator of morphogenesis 2
Synonyms
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1559 (G1)
Quality Score210
Status Validated
Chromosome17
Chromosomal Location49456022-49564343 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 49496120 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057610] [ENSMUST00000224595]
Predicted Effect probably benign
Transcript: ENSMUST00000057610
SMART Domains Protein: ENSMUSP00000052085
Gene: ENSMUSG00000040260

DomainStartEndE-ValueType
Drf_GBD 40 228 4.89e-61 SMART
Drf_FH3 231 429 1.19e-73 SMART
Blast:FH2 476 513 4e-10 BLAST
low complexity region 514 534 N/A INTRINSIC
low complexity region 539 576 N/A INTRINSIC
FH2 595 1085 7.36e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226030
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
MGI Phenotype PHENOTYPE: Homozygous KO in combination with homozygous Daam1 conditional KO increases the severity of the heart phenotype (abnormal ventricular morphology and pressure) of the Daam1 single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Heyl A G 4: 123,241,399 S62G probably damaging Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il12rb2 G T 6: 67,356,592 F234L probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
Lrrc4c T A 2: 97,630,772 M581K probably benign Het
M6pr A T 6: 122,315,074 I122L probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Olfr937 T C 9: 39,060,141 N175S probably benign Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Slco6c1 T A 1: 97,098,498 D334V probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Stk32a C A 18: 43,243,084 Q73K probably benign Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in Daam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Daam2 APN 17 49490304 missense possibly damaging 0.82
IGL02373:Daam2 APN 17 49473380 missense probably damaging 1.00
IGL02626:Daam2 APN 17 49490254 missense possibly damaging 0.46
IGL02793:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL02861:Daam2 APN 17 49469427 missense probably damaging 1.00
IGL02875:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL03370:Daam2 APN 17 49486501 missense probably benign 0.19
R0145:Daam2 UTSW 17 49480778 missense probably benign
R0310:Daam2 UTSW 17 49463924 critical splice donor site probably null
R0362:Daam2 UTSW 17 49480785 splice site probably null
R0423:Daam2 UTSW 17 49469421 nonsense probably null
R0883:Daam2 UTSW 17 49498883 utr 5 prime probably benign
R0928:Daam2 UTSW 17 49488227 missense probably benign 0.30
R1444:Daam2 UTSW 17 49480751 missense possibly damaging 0.89
R1733:Daam2 UTSW 17 49490203 missense possibly damaging 0.60
R1919:Daam2 UTSW 17 49485457 missense probably benign 0.00
R1930:Daam2 UTSW 17 49462213 splice site probably null
R1968:Daam2 UTSW 17 49483060 missense probably damaging 1.00
R2520:Daam2 UTSW 17 49480757 nonsense probably null
R3004:Daam2 UTSW 17 49460654 missense probably damaging 0.98
R3726:Daam2 UTSW 17 49469738 missense probably damaging 1.00
R3854:Daam2 UTSW 17 49458596 missense probably benign
R4833:Daam2 UTSW 17 49490145 missense possibly damaging 0.91
R4878:Daam2 UTSW 17 49460710 missense probably damaging 1.00
R5015:Daam2 UTSW 17 49476522 missense probably damaging 1.00
R5106:Daam2 UTSW 17 49476461 missense probably damaging 1.00
R5184:Daam2 UTSW 17 49494391 missense possibly damaging 0.50
R5419:Daam2 UTSW 17 49480754 missense possibly damaging 0.95
R5529:Daam2 UTSW 17 49459057 missense probably benign
R5974:Daam2 UTSW 17 49464473 missense probably damaging 1.00
R5979:Daam2 UTSW 17 49459204 missense possibly damaging 0.47
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6050:Daam2 UTSW 17 49486502 missense possibly damaging 0.78
R6180:Daam2 UTSW 17 49469666 missense probably damaging 0.99
R6225:Daam2 UTSW 17 49494439 missense probably damaging 0.98
R6385:Daam2 UTSW 17 49463936 missense probably damaging 1.00
R6426:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6427:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6428:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6539:Daam2 UTSW 17 49469711 missense probably damaging 1.00
R7090:Daam2 UTSW 17 49482945 missense probably damaging 0.99
R7108:Daam2 UTSW 17 49460674 missense probably damaging 1.00
R7487:Daam2 UTSW 17 49486482 missense probably benign 0.03
R7599:Daam2 UTSW 17 49480727 nonsense probably null
R7763:Daam2 UTSW 17 49490022 missense probably benign 0.04
V1662:Daam2 UTSW 17 49464601 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CGCGCAGGTATATTGTGTGAAATGCTA -3'
(R):5'- CGTTGGGAAGAGGAAGCTGGACT -3'

Sequencing Primer
(F):5'- acaacctcacatccctttcc -3'
(R):5'- CTCTCTGGGAGAAATATCATAGGC -3'
Posted On2014-04-13