Mutagenetix > Incidental Mutations

Incidental Mutation 'R1560:Gpr158'

170532

Institutional Source

Beutler Lab

Gene Symbol

Gpr158

Ensembl Gene

ENSMUSG00000045967

Gene Name

G protein-coupled receptor 158

Synonyms

5330427M13Rik

MMRRC Submission

039599-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21367542-21830547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21826314 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 742 (K742E)

Ref Sequence

ENSEMBL: ENSMUSP00000049708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055946]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055946
AA Change: K742E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: K742E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	110	125	N/A	INTRINSIC
SCOP:d1edmb_	313	359	5e-4	SMART
Blast:EGF	318	365	2e-27	BLAST
Pfam:7tm_3	426	669	1.2e-35	PFAM
low complexity region	840	863	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,626,042	T390A	probably benign	Het
Adamts8	T	A	9: 30,956,667	C596S	probably damaging	Het
Avl9	T	A	6: 56,725,128	Y89*	probably null	Het
Cacna1e	G	A	1: 154,421,104	R18*	probably null	Het
Cacng2	A	G	15: 78,013,318	F97S	probably benign	Het
Calu	A	G	6: 29,361,658	D107G	probably benign	Het
Capns2	G	A	8: 92,902,143	R220Q	probably damaging	Het
Catsperb	C	T	12: 101,625,726	T1105I	probably benign	Het
Cep350	T	C	1: 155,929,079	N753D	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dnah5	G	T	15: 28,420,003	V3816F	probably damaging	Het
Dzip3	T	C	16: 48,951,540		probably null	Het
Ep400	A	T	5: 110,671,106		probably null	Het
Epb41l2	T	A	10: 25,495,436		probably null	Het
Fetub	T	C	16: 22,939,367	V300A	probably benign	Het
Gabrb3	A	T	7: 57,816,295	M308L	probably damaging	Het
Galnt16	A	T	12: 80,601,792	D546V	possibly damaging	Het
Gimap8	G	T	6: 48,656,134	G296W	probably damaging	Het
Hmbs	T	C	9: 44,337,360	H72R	possibly damaging	Het
Krt16	A	G	11: 100,246,649	I410T	probably damaging	Het
Lamb3	G	A	1: 193,339,402	A971T	probably benign	Het
Lilra6	A	C	7: 3,911,408		probably null	Het
Mroh7	A	T	4: 106,711,254	M418K	possibly damaging	Het
Myh11	T	A	16: 14,226,620	K640*	probably null	Het
Nsd1	T	A	13: 55,246,720	C711*	probably null	Het
Olfr1216	T	C	2: 89,013,206	Y286C	probably damaging	Het
Olfr139	A	G	11: 74,044,615	S220P	probably damaging	Het
Olfr318	A	T	11: 58,720,687	Y120*	probably null	Het
Olfr346	T	A	2: 36,688,143	L47Q	probably damaging	Het
Otop3	A	T	11: 115,344,463	H307L	possibly damaging	Het
Plekhm3	T	C	1: 64,937,817	T165A	probably benign	Het
Poldip3	G	A	15: 83,138,326	R86W	probably damaging	Het
Rif1	A	T	2: 52,111,131	R1532S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc27a6	T	A	18: 58,579,832	L242*	probably null	Het
Spata45	T	C	1: 191,039,820	S80P	probably benign	Het
Taf4	A	G	2: 179,935,953	V525A	probably benign	Het
Tbck	A	G	3: 132,838,048	T887A	probably damaging	Het
Tnrc6c	C	T	11: 117,759,637	T1571I	probably damaging	Het
Trim38	A	G	13: 23,782,702	Y44C	probably benign	Het
Tsg101	A	T	7: 46,892,460		probably null	Het
Tsku	T	A	7: 98,352,944	D60V	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Upf1	G	A	8: 70,338,442	P550L	probably damaging	Het
Vipr2	A	G	12: 116,094,781	D106G	probably benign	Het
Vps13c	T	C	9: 67,936,463		probably null	Het
Washc4	T	C	10: 83,556,109	Y220H	probably damaging	Het
Wdr81	C	T	11: 75,451,623	W939*	probably null	Het
Zfp512b	T	C	2: 181,588,679	T473A	probably benign	Het

Other mutations in Gpr158

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Gpr158	APN	2	21368683	missense	probably damaging	1.00
IGL00469:Gpr158	APN	2	21746795	splice site	probably benign
IGL00706:Gpr158	APN	2	21746773	missense	probably damaging	1.00
IGL00780:Gpr158	APN	2	21826818	nonsense	probably null
IGL00885:Gpr158	APN	2	21649021	missense	probably damaging	1.00
IGL01339:Gpr158	APN	2	21369031	missense	possibly damaging	0.73
IGL01368:Gpr158	APN	2	21827098	missense	probably damaging	1.00
IGL02141:Gpr158	APN	2	21783290	missense	probably damaging	0.99
IGL02455:Gpr158	APN	2	21368700	missense	probably benign	0.00
IGL02554:Gpr158	APN	2	21826596	missense	probably benign
IGL02681:Gpr158	APN	2	21815630	missense	probably damaging	1.00
IGL02752:Gpr158	APN	2	21826827	missense	possibly damaging	0.95
IGL02756:Gpr158	APN	2	21827079	missense	possibly damaging	0.47
IGL03181:Gpr158	APN	2	21783161	missense	probably benign	0.02
IGL03258:Gpr158	APN	2	21825274	missense	probably damaging	1.00
IGL03386:Gpr158	APN	2	21826246	missense	probably damaging	1.00
PIT4810001:Gpr158	UTSW	2	21826871	missense	probably benign	0.01
R0071:Gpr158	UTSW	2	21810668	missense	probably benign	0.08
R0081:Gpr158	UTSW	2	21826717	missense	probably damaging	1.00
R0528:Gpr158	UTSW	2	21825208	missense	probably damaging	1.00
R0560:Gpr158	UTSW	2	21825274	missense	probably damaging	1.00
R0603:Gpr158	UTSW	2	21815669	missense	possibly damaging	0.67
R1561:Gpr158	UTSW	2	21815694	splice site	probably null
R1609:Gpr158	UTSW	2	21783293	missense	possibly damaging	0.61
R1741:Gpr158	UTSW	2	21827548	missense	probably benign	0.00
R1827:Gpr158	UTSW	2	21827318	missense	probably benign
R1854:Gpr158	UTSW	2	21369124	missense	probably damaging	1.00
R1871:Gpr158	UTSW	2	21815615	missense	probably damaging	1.00
R2151:Gpr158	UTSW	2	21827514	missense	possibly damaging	0.82
R2273:Gpr158	UTSW	2	21826863	missense	probably benign
R2275:Gpr158	UTSW	2	21826863	missense	probably benign
R3004:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R3151:Gpr158	UTSW	2	21576960	missense	possibly damaging	0.68
R3943:Gpr158	UTSW	2	21368559	missense	possibly damaging	0.65
R4238:Gpr158	UTSW	2	21368551	missense	probably damaging	1.00
R4379:Gpr158	UTSW	2	21825214	missense	probably damaging	1.00
R4381:Gpr158	UTSW	2	21827592	missense	probably damaging	1.00
R4464:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4467:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4496:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4506:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4530:Gpr158	UTSW	2	21369000	missense	probably benign	0.03
R4646:Gpr158	UTSW	2	21827053	missense	probably benign
R4798:Gpr158	UTSW	2	21783182	missense	probably damaging	1.00
R4882:Gpr158	UTSW	2	21825248	missense	probably damaging	0.98
R4943:Gpr158	UTSW	2	21827157	missense	probably damaging	1.00
R5334:Gpr158	UTSW	2	21827505	missense	probably benign	0.01
R5560:Gpr158	UTSW	2	21826290	missense	possibly damaging	0.67
R5600:Gpr158	UTSW	2	21827235	missense	probably benign
R5637:Gpr158	UTSW	2	21783272	missense	probably benign	0.00
R5701:Gpr158	UTSW	2	21746709	missense	probably damaging	1.00
R5744:Gpr158	UTSW	2	21368520	missense	probably damaging	1.00
R5911:Gpr158	UTSW	2	21369121	missense	possibly damaging	0.95
R5991:Gpr158	UTSW	2	21368508	missense	probably damaging	0.99
R6200:Gpr158	UTSW	2	21399416	missense	probably damaging	0.97
R6306:Gpr158	UTSW	2	21815611	missense	possibly damaging	0.84
R6324:Gpr158	UTSW	2	21810554	missense	probably damaging	1.00
R6384:Gpr158	UTSW	2	21826288	missense	probably damaging	1.00
R6698:Gpr158	UTSW	2	21827110	missense	probably damaging	1.00
R6997:Gpr158	UTSW	2	21648991	missense	possibly damaging	0.46
R7086:Gpr158	UTSW	2	21826575	missense	probably benign	0.01
R7175:Gpr158	UTSW	2	21368302	missense	probably benign	0.13
R7197:Gpr158	UTSW	2	21810601	missense	probably damaging	0.99
R7293:Gpr158	UTSW	2	21576939	missense	possibly damaging	0.47
R7427:Gpr158	UTSW	2	21827318	missense	probably benign
R7515:Gpr158	UTSW	2	21368281	missense	probably damaging	1.00
R7730:Gpr158	UTSW	2	21826347	missense	probably damaging	1.00
R8122:Gpr158	UTSW	2	21826863	missense	probably benign
R8311:Gpr158	UTSW	2	21368890	missense	probably benign	0.00
X0062:Gpr158	UTSW	2	21826369	missense	probably damaging	1.00
Z1176:Gpr158	UTSW	2	21810690	critical splice donor site	probably null
Z1177:Gpr158	UTSW	2	21827272	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- AAACACCACCGGGCTATTTTCTGTC -3'
(R):5'- CAGCGACTCCAAGGTTGAATTTTCG -3'

Sequencing Primer
(F):5'- GGGCTATTTTCTGTCTGAAACAC -3'
(R):5'- GCAAGCTGCTGGATTCTACAG -3'

Posted On

2014-04-13