Incidental Mutation 'R1560:Rif1'
ID 170534
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms D2Ertd145e, 6530403D07Rik, 5730435J01Rik
MMRRC Submission 039599-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1560 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 51962844-52012395 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52001143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1532 (R1532S)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069794
AA Change: R1532S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: R1532S

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: R1532S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: R1532S

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125322
AA Change: R49S
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,275,466 (GRCm39) T390A probably benign Het
Adamts8 T A 9: 30,867,963 (GRCm39) C596S probably damaging Het
Avl9 T A 6: 56,702,113 (GRCm39) Y89* probably null Het
Cacna1e G A 1: 154,296,850 (GRCm39) R18* probably null Het
Cacng2 A G 15: 77,897,518 (GRCm39) F97S probably benign Het
Calu A G 6: 29,361,657 (GRCm39) D107G probably benign Het
Capns2 G A 8: 93,628,771 (GRCm39) R220Q probably damaging Het
Catsperb C T 12: 101,591,985 (GRCm39) T1105I probably benign Het
Cep350 T C 1: 155,804,825 (GRCm39) N753D possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dnah5 G T 15: 28,420,149 (GRCm39) V3816F probably damaging Het
Dzip3 T C 16: 48,771,903 (GRCm39) probably null Het
Ep400 A T 5: 110,818,972 (GRCm39) probably null Het
Epb41l2 T A 10: 25,371,334 (GRCm39) probably null Het
Fetub T C 16: 22,758,117 (GRCm39) V300A probably benign Het
Gabrb3 A T 7: 57,466,043 (GRCm39) M308L probably damaging Het
Galnt16 A T 12: 80,648,566 (GRCm39) D546V possibly damaging Het
Gimap8 G T 6: 48,633,068 (GRCm39) G296W probably damaging Het
Gpr158 A G 2: 21,831,125 (GRCm39) K742E probably damaging Het
Hmbs T C 9: 44,248,657 (GRCm39) H72R possibly damaging Het
Krt16 A G 11: 100,137,475 (GRCm39) I410T probably damaging Het
Lamb3 G A 1: 193,021,710 (GRCm39) A971T probably benign Het
Lilra6 A C 7: 3,914,407 (GRCm39) probably null Het
Mroh7 A T 4: 106,568,451 (GRCm39) M418K possibly damaging Het
Myh11 T A 16: 14,044,484 (GRCm39) K640* probably null Het
Nsd1 T A 13: 55,394,533 (GRCm39) C711* probably null Het
Or1j17 T A 2: 36,578,155 (GRCm39) L47Q probably damaging Het
Or2ak5 A T 11: 58,611,513 (GRCm39) Y120* probably null Het
Or3a10 A G 11: 73,935,441 (GRCm39) S220P probably damaging Het
Or4c111 T C 2: 88,843,550 (GRCm39) Y286C probably damaging Het
Otop3 A T 11: 115,235,289 (GRCm39) H307L possibly damaging Het
Plekhm3 T C 1: 64,976,976 (GRCm39) T165A probably benign Het
Poldip3 G A 15: 83,022,527 (GRCm39) R86W probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Slc27a6 T A 18: 58,712,904 (GRCm39) L242* probably null Het
Spata45 T C 1: 190,772,017 (GRCm39) S80P probably benign Het
Taf4 A G 2: 179,577,746 (GRCm39) V525A probably benign Het
Tbck A G 3: 132,543,809 (GRCm39) T887A probably damaging Het
Tnrc6c C T 11: 117,650,463 (GRCm39) T1571I probably damaging Het
Trim38 A G 13: 23,966,685 (GRCm39) Y44C probably benign Het
Tsg101 A T 7: 46,542,208 (GRCm39) probably null Het
Tsku T A 7: 98,002,151 (GRCm39) D60V probably damaging Het
Ttc28 G A 5: 111,373,543 (GRCm39) S962N probably damaging Het
Upf1 G A 8: 70,791,092 (GRCm39) P550L probably damaging Het
Vipr2 A G 12: 116,058,401 (GRCm39) D106G probably benign Het
Vps13c T C 9: 67,843,745 (GRCm39) probably null Het
Washc4 T C 10: 83,391,973 (GRCm39) Y220H probably damaging Het
Wdr81 C T 11: 75,342,449 (GRCm39) W939* probably null Het
Zfp512b T C 2: 181,230,472 (GRCm39) T473A probably benign Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52,011,019 (GRCm39) missense probably damaging 0.96
IGL00711:Rif1 APN 2 52,001,082 (GRCm39) missense probably benign 0.00
IGL00721:Rif1 APN 2 52,009,129 (GRCm39) missense probably damaging 1.00
IGL01085:Rif1 APN 2 51,975,152 (GRCm39) missense possibly damaging 0.71
IGL01093:Rif1 APN 2 51,985,960 (GRCm39) missense probably damaging 1.00
IGL01107:Rif1 APN 2 52,001,315 (GRCm39) missense probably benign 0.00
IGL01138:Rif1 APN 2 52,001,534 (GRCm39) missense probably damaging 1.00
IGL01844:Rif1 APN 2 52,002,555 (GRCm39) missense probably benign 0.07
IGL02441:Rif1 APN 2 51,995,527 (GRCm39) missense probably benign 0.00
IGL02448:Rif1 APN 2 52,006,708 (GRCm39) missense probably damaging 0.99
IGL02563:Rif1 APN 2 51,967,077 (GRCm39) missense probably damaging 1.00
IGL02704:Rif1 APN 2 51,983,588 (GRCm39) missense probably damaging 1.00
IGL02946:Rif1 APN 2 52,000,137 (GRCm39) nonsense probably null
IGL03060:Rif1 APN 2 52,002,149 (GRCm39) missense probably damaging 0.97
IGL03206:Rif1 APN 2 51,993,634 (GRCm39) missense probably damaging 1.00
IGL03263:Rif1 APN 2 51,980,273 (GRCm39) missense probably damaging 0.99
IGL03267:Rif1 APN 2 51,967,000 (GRCm39) missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52,002,611 (GRCm39) missense probably benign 0.32
hifi UTSW 2 52,000,336 (GRCm39) unclassified probably benign
nietzsche UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52,001,970 (GRCm39) missense
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0104:Rif1 UTSW 2 52,000,104 (GRCm39) missense possibly damaging 0.77
R0268:Rif1 UTSW 2 51,980,298 (GRCm39) critical splice donor site probably null
R0276:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0278:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0288:Rif1 UTSW 2 52,000,025 (GRCm39) missense probably damaging 1.00
R0314:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0345:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0346:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0383:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R0384:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0387:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0388:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0456:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0477:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0505:Rif1 UTSW 2 52,000,749 (GRCm39) missense probably damaging 0.99
R0510:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0511:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0633:Rif1 UTSW 2 52,002,575 (GRCm39) missense probably benign 0.00
R0637:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0638:Rif1 UTSW 2 52,001,600 (GRCm39) missense probably benign 0.12
R0666:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0675:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0707:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0726:Rif1 UTSW 2 52,000,365 (GRCm39) missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0744:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0938:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0939:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0940:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0941:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0942:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0943:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1006:Rif1 UTSW 2 51,975,041 (GRCm39) missense probably damaging 0.99
R1052:Rif1 UTSW 2 52,001,574 (GRCm39) missense probably benign 0.01
R1061:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1175:Rif1 UTSW 2 51,997,640 (GRCm39) unclassified probably benign
R1183:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1184:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1271:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1332:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1336:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1351:Rif1 UTSW 2 52,001,567 (GRCm39) missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1527:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1563:Rif1 UTSW 2 51,963,235 (GRCm39) missense probably damaging 0.99
R1571:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1625:Rif1 UTSW 2 51,993,652 (GRCm39) missense probably benign 0.25
R1679:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1689:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1731:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1744:Rif1 UTSW 2 52,002,404 (GRCm39) missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1748:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1831:Rif1 UTSW 2 51,968,507 (GRCm39) nonsense probably null
R1902:Rif1 UTSW 2 52,006,685 (GRCm39) missense possibly damaging 0.93
R1964:Rif1 UTSW 2 51,988,421 (GRCm39) missense probably benign 0.01
R1978:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2000:Rif1 UTSW 2 51,971,310 (GRCm39) missense probably damaging 0.99
R2030:Rif1 UTSW 2 51,982,358 (GRCm39) missense probably damaging 1.00
R2056:Rif1 UTSW 2 51,983,588 (GRCm39) missense probably damaging 1.00
R2106:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2109:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2125:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2126:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2145:Rif1 UTSW 2 52,001,412 (GRCm39) missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2153:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2213:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2327:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2513:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2516:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2520:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2905:Rif1 UTSW 2 51,988,516 (GRCm39) missense probably damaging 0.99
R3005:Rif1 UTSW 2 51,972,776 (GRCm39) missense probably damaging 1.00
R3155:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3156:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3429:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3707:Rif1 UTSW 2 51,983,592 (GRCm39) missense probably damaging 1.00
R3907:Rif1 UTSW 2 52,002,557 (GRCm39) missense probably benign 0.03
R3978:Rif1 UTSW 2 52,006,759 (GRCm39) critical splice donor site probably null
R4023:Rif1 UTSW 2 52,011,099 (GRCm39) missense probably benign 0.01
R4052:Rif1 UTSW 2 51,988,483 (GRCm39) nonsense probably null
R4668:Rif1 UTSW 2 52,001,964 (GRCm39) missense probably benign 0.01
R4674:Rif1 UTSW 2 51,996,954 (GRCm39) missense probably null 1.00
R4715:Rif1 UTSW 2 51,963,151 (GRCm39) utr 5 prime probably benign
R4766:Rif1 UTSW 2 51,988,946 (GRCm39) missense probably damaging 1.00
R4783:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4785:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4869:Rif1 UTSW 2 51,983,623 (GRCm39) intron probably benign
R4911:Rif1 UTSW 2 52,000,530 (GRCm39) missense probably damaging 0.98
R4951:Rif1 UTSW 2 51,974,998 (GRCm39) splice site probably null
R5044:Rif1 UTSW 2 51,999,940 (GRCm39) missense probably damaging 0.99
R5088:Rif1 UTSW 2 51,982,307 (GRCm39) missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52,010,321 (GRCm39) missense probably damaging 1.00
R5187:Rif1 UTSW 2 51,971,301 (GRCm39) missense probably damaging 1.00
R5222:Rif1 UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
R5243:Rif1 UTSW 2 52,001,836 (GRCm39) missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52,010,983 (GRCm39) intron probably benign
R5476:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
R5496:Rif1 UTSW 2 51,988,928 (GRCm39) missense probably damaging 1.00
R5641:Rif1 UTSW 2 52,011,170 (GRCm39) missense possibly damaging 0.80
R5883:Rif1 UTSW 2 51,995,651 (GRCm39) critical splice donor site probably null
R5987:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5990:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5992:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6019:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6020:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6255:Rif1 UTSW 2 51,975,065 (GRCm39) missense probably damaging 1.00
R6342:Rif1 UTSW 2 52,009,168 (GRCm39) missense probably damaging 0.97
R6364:Rif1 UTSW 2 51,997,681 (GRCm39) missense probably damaging 0.97
R6747:Rif1 UTSW 2 51,968,275 (GRCm39) splice site probably null
R6928:Rif1 UTSW 2 51,985,973 (GRCm39) missense probably damaging 1.00
R6954:Rif1 UTSW 2 52,002,703 (GRCm39) missense probably benign 0.00
R7003:Rif1 UTSW 2 51,967,001 (GRCm39) missense probably benign 0.06
R7310:Rif1 UTSW 2 51,995,631 (GRCm39) missense probably benign 0.12
R7549:Rif1 UTSW 2 51,968,519 (GRCm39) missense possibly damaging 0.52
R7603:Rif1 UTSW 2 51,966,187 (GRCm39) missense probably damaging 1.00
R7673:Rif1 UTSW 2 51,978,666 (GRCm39) missense probably damaging 1.00
R7741:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R7777:Rif1 UTSW 2 52,006,368 (GRCm39) missense probably benign 0.00
R7910:Rif1 UTSW 2 51,968,399 (GRCm39) nonsense probably null
R7962:Rif1 UTSW 2 51,964,288 (GRCm39) missense probably damaging 1.00
R8264:Rif1 UTSW 2 51,980,290 (GRCm39) missense noncoding transcript
R8390:Rif1 UTSW 2 52,000,935 (GRCm39) missense probably damaging 1.00
R8479:Rif1 UTSW 2 52,002,563 (GRCm39) missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52,001,011 (GRCm39) missense probably damaging 0.96
R8762:Rif1 UTSW 2 52,001,742 (GRCm39) missense
R8785:Rif1 UTSW 2 52,000,493 (GRCm39) missense probably benign 0.06
R8890:Rif1 UTSW 2 51,988,875 (GRCm39) missense probably damaging 0.99
R9081:Rif1 UTSW 2 52,000,989 (GRCm39) missense probably damaging 0.99
R9225:Rif1 UTSW 2 52,001,862 (GRCm39) missense probably benign 0.22
R9284:Rif1 UTSW 2 51,998,564 (GRCm39) missense probably benign 0.00
R9300:Rif1 UTSW 2 52,001,151 (GRCm39) missense probably damaging 1.00
R9366:Rif1 UTSW 2 52,010,356 (GRCm39) missense
R9477:Rif1 UTSW 2 52,001,342 (GRCm39) missense probably benign 0.02
R9522:Rif1 UTSW 2 51,971,311 (GRCm39) missense probably damaging 1.00
R9573:Rif1 UTSW 2 52,000,466 (GRCm39) missense probably benign 0.29
R9630:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
X0064:Rif1 UTSW 2 51,984,645 (GRCm39) missense probably damaging 0.96
X0064:Rif1 UTSW 2 51,964,327 (GRCm39) missense probably benign 0.00
Z1177:Rif1 UTSW 2 51,978,660 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGAGAGAACTTCAGGGGAACC -3'
(R):5'- CTGAGCCGCTGCATTTACATCAAC -3'

Sequencing Primer
(F):5'- ACTTCAGGGGAACCCAGTG -3'
(R):5'- GCTGCATTTACATCAACATCAGG -3'
Posted On 2014-04-13