Mutagenetix > Incidental Mutation

Incidental Mutation 'R1560:Upf1'

170554

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

039599-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R1560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70338442 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 550 (P550L)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075666
AA Change: P561L

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: P561L

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: P550L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,626,042	T390A	probably benign	Het
Adamts8	T	A	9: 30,956,667	C596S	probably damaging	Het
Avl9	T	A	6: 56,725,128	Y89*	probably null	Het
Cacna1e	G	A	1: 154,421,104	R18*	probably null	Het
Cacng2	A	G	15: 78,013,318	F97S	probably benign	Het
Calu	A	G	6: 29,361,658	D107G	probably benign	Het
Capns2	G	A	8: 92,902,143	R220Q	probably damaging	Het
Catsperb	C	T	12: 101,625,726	T1105I	probably benign	Het
Cep350	T	C	1: 155,929,079	N753D	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dnah5	G	T	15: 28,420,003	V3816F	probably damaging	Het
Dzip3	T	C	16: 48,951,540		probably null	Het
Ep400	A	T	5: 110,671,106		probably null	Het
Epb41l2	T	A	10: 25,495,436		probably null	Het
Fetub	T	C	16: 22,939,367	V300A	probably benign	Het
Gabrb3	A	T	7: 57,816,295	M308L	probably damaging	Het
Galnt16	A	T	12: 80,601,792	D546V	possibly damaging	Het
Gimap8	G	T	6: 48,656,134	G296W	probably damaging	Het
Gpr158	A	G	2: 21,826,314	K742E	probably damaging	Het
Hmbs	T	C	9: 44,337,360	H72R	possibly damaging	Het
Krt16	A	G	11: 100,246,649	I410T	probably damaging	Het
Lamb3	G	A	1: 193,339,402	A971T	probably benign	Het
Lilra6	A	C	7: 3,911,408		probably null	Het
Mroh7	A	T	4: 106,711,254	M418K	possibly damaging	Het
Myh11	T	A	16: 14,226,620	K640*	probably null	Het
Nsd1	T	A	13: 55,246,720	C711*	probably null	Het
Olfr1216	T	C	2: 89,013,206	Y286C	probably damaging	Het
Olfr139	A	G	11: 74,044,615	S220P	probably damaging	Het
Olfr318	A	T	11: 58,720,687	Y120*	probably null	Het
Olfr346	T	A	2: 36,688,143	L47Q	probably damaging	Het
Otop3	A	T	11: 115,344,463	H307L	possibly damaging	Het
Plekhm3	T	C	1: 64,937,817	T165A	probably benign	Het
Poldip3	G	A	15: 83,138,326	R86W	probably damaging	Het
Rif1	A	T	2: 52,111,131	R1532S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc27a6	T	A	18: 58,579,832	L242*	probably null	Het
Spata45	T	C	1: 191,039,820	S80P	probably benign	Het
Taf4	A	G	2: 179,935,953	V525A	probably benign	Het
Tbck	A	G	3: 132,838,048	T887A	probably damaging	Het
Tnrc6c	C	T	11: 117,759,637	T1571I	probably damaging	Het
Trim38	A	G	13: 23,782,702	Y44C	probably benign	Het
Tsg101	A	T	7: 46,892,460		probably null	Het
Tsku	T	A	7: 98,352,944	D60V	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Vipr2	A	G	12: 116,094,781	D106G	probably benign	Het
Vps13c	T	C	9: 67,936,463		probably null	Het
Washc4	T	C	10: 83,556,109	Y220H	probably damaging	Het
Wdr81	C	T	11: 75,451,623	W939*	probably null	Het
Zfp512b	T	C	2: 181,588,679	T473A	probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGACAAGTCTCTCCAGATCCTCTGC -3'
(R):5'- GATGCTGACAGCCTATTCCACTCTC -3'

Sequencing Primer
(F):5'- ACCATGAGAAGTTCTCTCTCAG -3'
(R):5'- CCAAGTAACATCGCTGTGGA -3'

Posted On

2014-04-13