Incidental Mutation 'R1560:Adamts8'
ID170556
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30956667 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 596 (C596S)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect probably damaging
Transcript: ENSMUST00000068135
AA Change: C596S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: C596S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163037
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214688
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1066:Adamts8 UTSW 9 30956541 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1592:Adamts8 UTSW 9 30943176 missense probably damaging 0.99
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2087:Adamts8 UTSW 9 30962112 missense probably damaging 1.00
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4165:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R4425:Adamts8 UTSW 9 30956656 missense possibly damaging 0.55
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5544:Adamts8 UTSW 9 30952703 missense probably damaging 1.00
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCGAGGCACGCCATCATTAAG -3'
(R):5'- TCTCTCAACAGCTCAGAAGACCAGG -3'

Sequencing Primer
(F):5'- acgccatcattaagcaagc -3'
(R):5'- CAGCTCAGAAGACCAGGACAAG -3'
Posted On2014-04-13