Incidental Mutation 'R1560:Vipr2'
ID170570
Institutional Source Beutler Lab
Gene Symbol Vipr2
Ensembl Gene ENSMUSG00000011171
Gene Namevasoactive intestinal peptide receptor 2
SynonymsVPAC2R, VPAC2, VIP receptor subtype 2, Vip2
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116077726-116146261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116094781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 106 (D106G)
Ref Sequence ENSEMBL: ENSMUSP00000011315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011315]
Predicted Effect probably benign
Transcript: ENSMUST00000011315
AA Change: D106G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000011315
Gene: ENSMUSG00000011171
AA Change: D106G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 47 117 8.35e-25 SMART
Pfam:7tm_2 122 370 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177199
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced delayed-type hypersensitivity (type IV) and reduced immediate-type hypersensitivity (type I). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Vipr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Vipr2 APN 12 116138748 splice site probably null
IGL02233:Vipr2 APN 12 116094736 missense probably damaging 0.99
IGL02691:Vipr2 APN 12 116136229 missense probably benign 0.11
PIT4377001:Vipr2 UTSW 12 116094798 missense probably benign 0.01
R0135:Vipr2 UTSW 12 116142827 missense probably benign 0.00
R0207:Vipr2 UTSW 12 116142882 missense probably damaging 1.00
R1389:Vipr2 UTSW 12 116137330 missense probably benign 0.01
R1575:Vipr2 UTSW 12 116144272 missense probably benign
R1696:Vipr2 UTSW 12 116139157 missense probably benign 0.13
R1970:Vipr2 UTSW 12 116136206 missense probably benign 0.01
R2010:Vipr2 UTSW 12 116122810 critical splice donor site probably null
R3873:Vipr2 UTSW 12 116136104 unclassified probably benign
R4713:Vipr2 UTSW 12 116080131 missense probably benign 0.00
R4953:Vipr2 UTSW 12 116144256 missense probably benign 0.07
R6041:Vipr2 UTSW 12 116142984 missense probably damaging 1.00
R6337:Vipr2 UTSW 12 116122743 nonsense probably null
R6902:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R6946:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R7763:Vipr2 UTSW 12 116122718 missense probably damaging 1.00
X0066:Vipr2 UTSW 12 116142945 splice site probably null
X0067:Vipr2 UTSW 12 116139172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATACAGTGTGTTCACTGGACCC -3'
(R):5'- CGGCAAATCGCAAATGCCAGAG -3'

Sequencing Primer
(F):5'- TCTCAAGAAGGAAGCTGTGC -3'
(R):5'- TGCCAGAGCATATCAGAGAC -3'
Posted On2014-04-13