Incidental Mutation 'R1560:Poldip3'
ID170576
Institutional Source Beutler Lab
Gene Symbol Poldip3
Ensembl Gene ENSMUSG00000041815
Gene Namepolymerase (DNA-directed), delta interacting protein 3
Synonyms1110008P04Rik, PDIP46
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83125976-83149384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83138326 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 86 (R86W)
Ref Sequence ENSEMBL: ENSMUSP00000120859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000129372]
Predicted Effect probably damaging
Transcript: ENSMUST00000058793
AA Change: R86W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100375
AA Change: R86W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129372
AA Change: R86W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120859
Gene: ENSMUSG00000041815
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 153 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150926
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Poldip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Poldip3 APN 15 83138479 missense probably damaging 1.00
IGL02887:Poldip3 APN 15 83129268 unclassified probably benign
R0143:Poldip3 UTSW 15 83127943 missense probably damaging 1.00
R0201:Poldip3 UTSW 15 83135296 missense probably benign 0.00
R0511:Poldip3 UTSW 15 83138235 missense probably damaging 1.00
R2302:Poldip3 UTSW 15 83129268 unclassified probably benign
R3755:Poldip3 UTSW 15 83131475 unclassified probably benign
R3756:Poldip3 UTSW 15 83131475 unclassified probably benign
R4785:Poldip3 UTSW 15 83131501 missense probably damaging 1.00
R4917:Poldip3 UTSW 15 83132575 critical splice donor site probably null
R4965:Poldip3 UTSW 15 83137505 missense possibly damaging 0.80
R5009:Poldip3 UTSW 15 83133194 missense probably damaging 1.00
R5030:Poldip3 UTSW 15 83138191 missense possibly damaging 0.67
R5992:Poldip3 UTSW 15 83129229 missense probably damaging 0.96
R6638:Poldip3 UTSW 15 83133200 missense probably damaging 1.00
R7028:Poldip3 UTSW 15 83131497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGACCAACATCTGGAACAAAC -3'
(R):5'- TCAGTGTCAGGCCAGGAATTGGAG -3'

Sequencing Primer
(F):5'- CACAACCTACCTGGATAGTTTTGG -3'
(R):5'- CCAGGAATTGGAGGTGTCC -3'
Posted On2014-04-13