Incidental Mutation 'R1560:Slc27a6'
ID170581
Institutional Source Beutler Lab
Gene Symbol Slc27a6
Ensembl Gene ENSMUSG00000024600
Gene Namesolute carrier family 27 (fatty acid transporter), member 6
Synonyms4732438L20Rik, FATP6
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location58556257-58612773 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 58579832 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 242 (L242*)
Ref Sequence ENSEMBL: ENSMUSP00000025500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025500]
Predicted Effect probably null
Transcript: ENSMUST00000025500
AA Change: L242*
SMART Domains Protein: ENSMUSP00000025500
Gene: ENSMUSG00000024600
AA Change: L242*

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:AMP-binding 60 487 5.3e-71 PFAM
Pfam:AMP-binding_C 495 571 2.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fatty acid transport protein family (FATP). FATPs are involved in the uptake of long-chain fatty acids and have unique expression patterns. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Slc27a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Slc27a6 APN 18 58556764 missense probably benign
IGL01419:Slc27a6 APN 18 58609209 missense probably benign 0.00
IGL01638:Slc27a6 APN 18 58607813 missense probably damaging 1.00
IGL02067:Slc27a6 APN 18 58612191 missense probably benign 0.00
IGL02612:Slc27a6 APN 18 58556905 missense probably benign 0.00
IGL03118:Slc27a6 APN 18 58556743 missense probably benign 0.00
R0096:Slc27a6 UTSW 18 58598757 splice site probably benign
R0096:Slc27a6 UTSW 18 58598757 splice site probably benign
R0255:Slc27a6 UTSW 18 58609865 missense possibly damaging 0.69
R0449:Slc27a6 UTSW 18 58609165 splice site probably null
R0599:Slc27a6 UTSW 18 58556813 missense probably damaging 1.00
R0711:Slc27a6 UTSW 18 58598757 splice site probably benign
R1082:Slc27a6 UTSW 18 58556560 missense probably damaging 0.97
R1942:Slc27a6 UTSW 18 58556798 missense probably damaging 0.99
R2424:Slc27a6 UTSW 18 58605117 missense probably benign 0.20
R3796:Slc27a6 UTSW 18 58598751 splice site probably benign
R4718:Slc27a6 UTSW 18 58605066 missense probably benign 0.03
R4803:Slc27a6 UTSW 18 58572033 missense possibly damaging 0.59
R5714:Slc27a6 UTSW 18 58598553 missense probably damaging 0.97
R5773:Slc27a6 UTSW 18 58582173 missense probably damaging 1.00
R5996:Slc27a6 UTSW 18 58612234 missense possibly damaging 0.89
R6049:Slc27a6 UTSW 18 58598660 missense probably damaging 1.00
R6441:Slc27a6 UTSW 18 58572058 missense probably benign 0.06
R6701:Slc27a6 UTSW 18 58579875 missense probably benign 0.01
R6703:Slc27a6 UTSW 18 58609839 missense probably benign 0.19
R6809:Slc27a6 UTSW 18 58605054 missense probably benign 0.00
R7514:Slc27a6 UTSW 18 58612221 nonsense probably null
R7536:Slc27a6 UTSW 18 58556626 missense probably damaging 1.00
R7615:Slc27a6 UTSW 18 58609183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAACCTCTGCCTGCCAACA -3'
(R):5'- AGGGAGTCTATACCACAAGGGCAAA -3'

Sequencing Primer
(F):5'- aattttttcttctccacctccattc -3'
(R):5'- AATGTGTCCTTTCCACACATAGTG -3'
Posted On2014-04-13