Incidental Mutation 'R1561:Crocc'
ID170593
Institutional Source Beutler Lab
Gene Symbol Crocc
Ensembl Gene ENSMUSG00000040860
Gene Nameciliary rootlet coiled-coil, rootletin
Synonyms
MMRRC Submission 039600-MU
Accession Numbers

Genbank: NM_172122;MGI: 3529431

Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R1561 (G1)
Quality Score110
Status Not validated
Chromosome4
Chromosomal Location141016637-141060550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141030268 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 905 (E905K)
Ref Sequence ENSEMBL: ENSMUSP00000126543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000168157]
Predicted Effect probably damaging
Transcript: ENSMUST00000040222
AA Change: E905K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860
AA Change: E905K

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097816
AA Change: E905K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860
AA Change: E905K

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102491
AA Change: E1069K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860
AA Change: E1069K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151455
Predicted Effect probably damaging
Transcript: ENSMUST00000168157
AA Change: E905K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860
AA Change: E905K

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show no apparent functional deficits in phototransduction and ciliary beating in sensory and motile cilia. However, photoreceptors degenerate over time, and lungs appear prone to pathological changes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Crocc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Crocc APN 4 141022112 missense probably damaging 1.00
IGL01474:Crocc APN 4 141035392 splice site probably benign
IGL01859:Crocc APN 4 141029290 missense probably benign 0.07
IGL02161:Crocc APN 4 141033991 missense probably benign 0.01
IGL02244:Crocc APN 4 141037920 missense probably benign 0.00
IGL02970:Crocc APN 4 141030246 missense possibly damaging 0.49
N/A:Crocc UTSW 4 141021746 missense probably damaging 1.00
R0158:Crocc UTSW 4 141042242 splice site probably benign
R0280:Crocc UTSW 4 141028426 missense probably damaging 1.00
R0448:Crocc UTSW 4 141042191 missense probably damaging 1.00
R0532:Crocc UTSW 4 141030247 missense possibly damaging 0.95
R0597:Crocc UTSW 4 141019913 missense probably benign 0.06
R0597:Crocc UTSW 4 141017071 missense probably benign
R0761:Crocc UTSW 4 141029776 missense probably benign 0.00
R0761:Crocc UTSW 4 141047076 missense probably benign 0.01
R1238:Crocc UTSW 4 141035364 missense probably benign 0.00
R1460:Crocc UTSW 4 141029240 nonsense probably null
R1515:Crocc UTSW 4 141019737 missense probably benign 0.00
R1557:Crocc UTSW 4 141025465 missense probably damaging 0.96
R1641:Crocc UTSW 4 141017077 missense probably benign 0.00
R1709:Crocc UTSW 4 141026099 critical splice donor site probably null
R1785:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1786:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1793:Crocc UTSW 4 141019309 missense probably damaging 1.00
R1897:Crocc UTSW 4 141018736 missense probably damaging 1.00
R1935:Crocc UTSW 4 141034058 missense possibly damaging 0.78
R2037:Crocc UTSW 4 141046942 critical splice donor site probably null
R2127:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2129:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2130:Crocc UTSW 4 141029102 missense probably benign 0.04
R2136:Crocc UTSW 4 141032954 missense probably damaging 1.00
R2298:Crocc UTSW 4 141025459 missense probably benign 0.30
R2847:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2848:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2913:Crocc UTSW 4 141020350 missense probably damaging 1.00
R3415:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3416:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3417:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R4082:Crocc UTSW 4 141033971 splice site probably null
R4454:Crocc UTSW 4 141020405 missense possibly damaging 0.52
R4591:Crocc UTSW 4 141018672 missense probably damaging 1.00
R4597:Crocc UTSW 4 141019777 missense probably damaging 1.00
R4984:Crocc UTSW 4 141034452 missense probably damaging 1.00
R4992:Crocc UTSW 4 141046666 missense probably damaging 0.98
R5109:Crocc UTSW 4 141028411 missense probably damaging 1.00
R5143:Crocc UTSW 4 141041039 missense probably benign 0.01
R5381:Crocc UTSW 4 141029311 missense possibly damaging 0.95
R5684:Crocc UTSW 4 141051144 missense probably damaging 0.99
R5757:Crocc UTSW 4 141043564 missense probably damaging 1.00
R5795:Crocc UTSW 4 141041807 frame shift probably null
R5796:Crocc UTSW 4 141041807 frame shift probably null
R5798:Crocc UTSW 4 141041807 frame shift probably null
R5815:Crocc UTSW 4 141035196 missense probably damaging 0.99
R5955:Crocc UTSW 4 141017918 missense possibly damaging 0.75
R6031:Crocc UTSW 4 141034357 critical splice donor site probably null
R6063:Crocc UTSW 4 141041721 missense probably benign 0.08
R6063:Crocc UTSW 4 141046540 missense probably damaging 1.00
R7086:Crocc UTSW 4 141047057 missense possibly damaging 0.47
R7282:Crocc UTSW 4 141022341 missense probably damaging 1.00
R7293:Crocc UTSW 4 141043556 missense probably benign 0.17
R7404:Crocc UTSW 4 141026186 missense possibly damaging 0.46
R7571:Crocc UTSW 4 141046049 critical splice acceptor site probably null
R7646:Crocc UTSW 4 141021655 missense probably null 0.94
R7782:Crocc UTSW 4 141025286 missense probably benign 0.05
R8053:Crocc UTSW 4 141042919 critical splice donor site unknown
X0065:Crocc UTSW 4 141041792 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AGTAGTCTCACCAAGGTGGAGCTG -3'
(R):5'- GGCACTTGCTGATCCTTCCAAATTG -3'

Sequencing Primer
(F):5'- AAGGGCTGGACCTTCCAC -3'
(R):5'- ccaggggggaagttgaag -3'
Posted On2014-04-13