Incidental Mutation 'R1561:Chfr'
ID 170596
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R1561 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110158808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 472 (D472V)
Ref Sequence ENSEMBL: ENSMUSP00000014812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably benign
Transcript: ENSMUST00000014812
AA Change: D472V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: D472V

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112519
AA Change: D473V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: D473V

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197968
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably benign
Transcript: ENSMUST00000198633
AA Change: D401V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: D401V

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200403
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGCTGTGGATTCTCAAATGCTAGAC -3'
(R):5'- ACACTGTGCCCTTGATATCCAGTAGAG -3'

Sequencing Primer
(F):5'- TGCTAGACAAATATACTCACTGAGC -3'
(R):5'- atacatccaaacaactcttgtacc -3'
Posted On 2014-04-13