Incidental Mutation 'R1561:D6Ertd527e'
ID 170603
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene Name DNA segment, Chr 6, ERATO Doi 527, expressed
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # R1561 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 87104746-87112997 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 87111524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 223 (T223S)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
AlphaFold A0A0N4SWI3
Predicted Effect unknown
Transcript: ENSMUST00000170124
AA Change: T222S
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: T222S

low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203725
Predicted Effect unknown
Transcript: ENSMUST00000203747
AA Change: T222S
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: T222S

low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204927
AA Change: T223S
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: T223S

low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205257
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87111317 missense unknown
R0739_D6Ertd527e_618 UTSW 6 87111668 missense unknown
sonenschein UTSW 6 87111524 missense unknown
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0992:D6Ertd527e UTSW 6 87111524 missense unknown
R0993:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1196:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R4836:D6Ertd527e UTSW 6 87111424 small insertion probably benign
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
R7821:D6Ertd527e UTSW 6 87110897 missense unknown
R8047:D6Ertd527e UTSW 6 87111472 missense unknown
R8827:D6Ertd527e UTSW 6 87111244 missense unknown
R9038:D6Ertd527e UTSW 6 87112251 makesense probably null
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcagcatcagcaactatgac -3'
(R):5'- tactgctgctgctgctg -3'
Posted On 2014-04-13