Incidental Mutation 'R1561:Sf3a1'
ID170620
Institutional Source Beutler Lab
Gene Symbol Sf3a1
Ensembl Gene ENSMUSG00000002129
Gene Namesplicing factor 3a, subunit 1
Synonyms
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1561 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location4160350-4182541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4179217 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 726 (V726A)
Ref Sequence ENSEMBL: ENSMUSP00000002198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002198]
PDB Structure
Solution structure of Ubiquitin-like domain in SF3a120 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000002198
AA Change: V726A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002198
Gene: ENSMUSG00000002129
AA Change: V726A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SWAP 50 103 4.99e-30 SMART
low complexity region 118 138 N/A INTRINSIC
SWAP 164 217 3.22e-24 SMART
Pfam:PRP21_like_P 227 469 7e-81 PFAM
low complexity region 552 560 N/A INTRINSIC
low complexity region 574 589 N/A INTRINSIC
low complexity region 624 673 N/A INTRINSIC
UBQ 713 784 6.52e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133095
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Sf3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sf3a1 APN 11 4171063 missense probably damaging 1.00
IGL02883:Sf3a1 APN 11 4179192 missense probably damaging 1.00
IGL03061:Sf3a1 APN 11 4175493 missense probably damaging 1.00
R1469:Sf3a1 UTSW 11 4175380 splice site probably benign
R1905:Sf3a1 UTSW 11 4176678 missense probably benign 0.01
R1993:Sf3a1 UTSW 11 4179177 missense possibly damaging 0.51
R2264:Sf3a1 UTSW 11 4177443 missense probably benign 0.28
R3935:Sf3a1 UTSW 11 4180024 splice site probably null
R3936:Sf3a1 UTSW 11 4180024 splice site probably null
R4065:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4067:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4245:Sf3a1 UTSW 11 4167774 missense probably damaging 1.00
R5167:Sf3a1 UTSW 11 4177456 missense possibly damaging 0.71
R5434:Sf3a1 UTSW 11 4174041 missense probably damaging 1.00
R7471:Sf3a1 UTSW 11 4167724 missense possibly damaging 0.94
R7506:Sf3a1 UTSW 11 4177561 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATGAAGCCTGTGTAGTGTCACACC -3'
(R):5'- GGCAGGACCCTTGCTTACTTCATAC -3'

Sequencing Primer
(F):5'- GGTATCAGCAGTAAAGGGGTG -3'
(R):5'- TCTGTTTCCCCGCAGGC -3'
Posted On2014-04-13