Incidental Mutation 'R1561:Pdzrn4'
ID 170634
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
MMRRC Submission 039600-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R1561 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92575518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 308 (V308A)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect probably benign
Transcript: ENSMUST00000035399
AA Change: V69A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: V69A

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169942
AA Change: V308A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: V308A

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229173
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 A G 17: 57,184,431 (GRCm39) N69D probably benign Het
Alms1 T A 6: 85,606,034 (GRCm39) Y2561* probably null Het
Ap1g2 T C 14: 55,342,344 (GRCm39) E171G probably damaging Het
Atg7 T C 6: 114,678,133 (GRCm39) V341A possibly damaging Het
Bace1 G T 9: 45,750,492 (GRCm39) R56L probably benign Het
Cd200l1 A G 16: 45,262,875 (GRCm39) V88A possibly damaging Het
Chfr A T 5: 110,306,674 (GRCm39) D472V probably benign Het
Ckap2l G A 2: 129,112,645 (GRCm39) T621I probably benign Het
Cmip A G 8: 118,180,589 (GRCm39) T554A probably benign Het
Crocc C T 4: 140,757,579 (GRCm39) E905K probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
F5 C A 1: 164,014,472 (GRCm39) S581* probably null Het
Fam227a T A 15: 79,520,963 (GRCm39) Y291F possibly damaging Het
Gpr151 A T 18: 42,712,221 (GRCm39) S152R probably benign Het
Gpr158 A T 2: 21,820,505 (GRCm39) probably null Het
Kcna5 T C 6: 126,511,546 (GRCm39) Y194C probably damaging Het
Khsrp A G 17: 57,332,639 (GRCm39) S214P probably benign Het
Mrgprb1 C G 7: 48,096,873 (GRCm39) probably null Het
Mrnip C T 11: 50,067,676 (GRCm39) T30I probably damaging Het
Mtus2 A C 5: 148,013,362 (GRCm39) K52Q probably benign Het
Naca G T 10: 127,876,267 (GRCm39) probably benign Het
Obscn T G 11: 58,926,899 (GRCm39) T5539P probably damaging Het
Or13p3 T A 4: 118,566,751 (GRCm39) I49N probably damaging Het
Or9m1 C T 2: 87,733,505 (GRCm39) V172I probably benign Het
Ovca2 A G 11: 75,068,805 (GRCm39) L198P probably damaging Het
Pkd1l3 A G 8: 110,341,445 (GRCm39) I99M unknown Het
Polr3b T A 10: 84,470,776 (GRCm39) M139K probably damaging Het
Prkag2 T C 5: 25,076,593 (GRCm39) Y191C probably damaging Het
Prss47 A T 13: 65,194,062 (GRCm39) C278S probably damaging Het
Ptprm T C 17: 67,247,536 (GRCm39) T600A probably damaging Het
Ruvbl1 T C 6: 88,456,136 (GRCm39) V70A probably damaging Het
Sf3a1 T C 11: 4,129,217 (GRCm39) V726A probably benign Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Slc26a3 A G 12: 31,516,451 (GRCm39) N603S probably benign Het
Slc2a1 A G 4: 118,993,606 (GRCm39) E481G possibly damaging Het
Slc35a5 A C 16: 44,971,884 (GRCm39) S127A possibly damaging Het
Spen C A 4: 141,199,694 (GRCm39) G2978* probably null Het
Srrt T A 5: 137,298,281 (GRCm39) E297V probably benign Het
Srsf4 T A 4: 131,625,006 (GRCm39) D134E probably damaging Het
Tdrd6 G A 17: 43,936,515 (GRCm39) S1511L probably damaging Het
Tmem65 T A 15: 58,694,707 (GRCm39) I91F probably benign Het
Top2b A G 14: 16,398,993 (GRCm38) K538E possibly damaging Het
Trappc8 G A 18: 20,974,680 (GRCm39) R883* probably null Het
Ttc28 G A 5: 111,373,543 (GRCm39) S962N probably damaging Het
Vav3 T C 3: 109,402,154 (GRCm39) probably null Het
Vmn1r42 C T 6: 89,822,363 (GRCm39) G69S probably damaging Het
Zan A T 5: 137,379,100 (GRCm39) Y5333* probably null Het
Zfp994 A C 17: 22,420,206 (GRCm39) F248V probably damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92,667,692 (GRCm39) missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92,578,418 (GRCm39) missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7096:Pdzrn4 UTSW 15 92,295,384 (GRCm39) missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92,668,818 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9555:Pdzrn4 UTSW 15 92,297,703 (GRCm39) missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92,294,949 (GRCm39) missense probably benign
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTGCCTGAAGATTAGGGGCAAC -3'
(R):5'- AACTGCCAACTTCTGGGGTGTCTG -3'

Sequencing Primer
(F):5'- GGGGCAACATTTTCTAATGCAG -3'
(R):5'- GCCTACTTTCAAAAGTGAACGG -3'
Posted On 2014-04-13