Incidental Mutation 'R1561:Pdzrn4'
ID 170634
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, LNX4, SAMCAP3L
MMRRC Submission 039600-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.280) question?
Stock # R1561 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 92396881-92771819 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92677637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 308 (V308A)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect probably benign
Transcript: ENSMUST00000035399
AA Change: V69A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: V69A

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169942
AA Change: V308A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: V308A

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229173
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92746278 missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92401926 splice site probably null
IGL02103:Pdzrn4 APN 15 92769887 missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92770696 missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92769850 missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92770391 missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92769881 missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92770319 missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92757657 missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92757711 missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92770271 missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92771013 makesense probably null
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92677712 missense probably benign
R1503:Pdzrn4 UTSW 15 92399804 missense probably damaging 0.99
R1584:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92401974 missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92746309 splice site probably null
R2061:Pdzrn4 UTSW 15 92770160 missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92769811 missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92399749 missense probably benign
R4032:Pdzrn4 UTSW 15 92769533 missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92770864 missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92402017 missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92770589 missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92769842 missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92770252 nonsense probably null
R4900:Pdzrn4 UTSW 15 92770757 missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92677621 missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92770925 missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92397374 missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92680537 missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92677574 missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92770422 nonsense probably null
R7096:Pdzrn4 UTSW 15 92397503 missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92770067 missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92677724 missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92743595 missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92770937 missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92397335 missense probably benign
R9555:Pdzrn4 UTSW 15 92399822 missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92401996 missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92397068 missense probably benign
R9763:Pdzrn4 UTSW 15 92770495 missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92680472 missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92677709 missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92680512 missense possibly damaging 0.92
X0065:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92396957 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTGCCTGAAGATTAGGGGCAAC -3'
(R):5'- AACTGCCAACTTCTGGGGTGTCTG -3'

Sequencing Primer
(F):5'- GGGGCAACATTTTCTAATGCAG -3'
(R):5'- GCCTACTTTCAAAAGTGAACGG -3'
Posted On 2014-04-13