Incidental Mutation 'R1562:Zdbf2'
ID 170646
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 039601-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R1562 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 63273265-63314576 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63303588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 375 (S375R)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: S375R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S375R

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083151
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: S375R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S375R

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,198 I134F probably damaging Het
Abca2 A G 2: 25,446,319 I2201V probably benign Het
Adam22 T C 5: 8,095,007 N817S probably damaging Het
Alox12 C A 11: 70,250,165 R348L probably damaging Het
Asb17 A T 3: 153,853,506 T285S probably benign Het
Casp4 T C 9: 5,324,733 S182P possibly damaging Het
Cenpe T C 3: 135,238,394 M985T possibly damaging Het
Clcn1 C T 6: 42,300,235 P420L probably benign Het
Coro2a T C 4: 46,548,917 I126V probably benign Het
Cubn T C 2: 13,427,967 Y1181C probably damaging Het
Cyp2d22 A T 15: 82,373,978 L147Q probably damaging Het
D430042O09Rik C A 7: 125,842,848 S643Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fat2 T C 11: 55,309,974 N758S probably damaging Het
Fbxo43 T C 15: 36,163,016 D15G probably damaging Het
Flt3 T C 5: 147,344,513 E803G probably damaging Het
Folr1 T G 7: 101,858,594 D213A probably damaging Het
Fus T C 7: 127,979,922 V359A probably damaging Het
Gabrb3 C T 7: 57,765,514 R111* probably null Het
Gm17324 T C 9: 78,448,682 probably benign Het
Hormad2 A T 11: 4,408,848 probably null Het
Ifi27l2b T A 12: 103,456,521 probably null Het
Isg20 G T 7: 78,920,143 C176F probably benign Het
Krt15 C A 11: 100,133,181 V346L probably benign Het
Med13l A G 5: 118,738,519 K920R probably damaging Het
Mlh3 A T 12: 85,266,920 F831I probably benign Het
Mtmr9 A G 14: 63,534,337 S267P probably benign Het
Mybpc1 C T 10: 88,553,331 A406T probably damaging Het
Myh1 T C 11: 67,211,370 M829T probably benign Het
Myo10 A G 15: 25,780,411 Q209R possibly damaging Het
Nceh1 T A 3: 27,239,552 V153D probably damaging Het
Olfr1195 T A 2: 88,683,079 I218F probably benign Het
Olfr348 A G 2: 36,786,684 D53G probably damaging Het
Olfr694 C T 7: 106,688,980 M250I probably benign Het
Olfr898 C A 9: 38,349,362 S87* probably null Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pcnt G A 10: 76,367,330 T2646M probably benign Het
Phf10 A T 17: 14,946,250 C453S probably damaging Het
Plcb4 T A 2: 135,970,447 probably null Het
Plekhh1 A G 12: 79,076,708 H1185R probably benign Het
Prmt3 G T 7: 49,826,854 V404L probably benign Het
Ptprb T A 10: 116,339,467 D1122E probably benign Het
Rars A G 11: 35,821,094 probably null Het
Rasa2 G T 9: 96,545,750 N687K possibly damaging Het
Rbm11 A G 16: 75,596,535 T40A probably damaging Het
Rem2 T C 14: 54,476,318 V16A probably benign Het
Rlf A T 4: 121,150,391 M574K possibly damaging Het
Rpap3 A T 15: 97,694,217 V186D possibly damaging Het
Sertad3 G A 7: 27,476,623 E161K probably damaging Het
Sh3gl2 T C 4: 85,385,893 S278P probably benign Het
Strn3 T C 12: 51,633,618 T400A probably benign Het
Sycp2 A T 2: 178,382,385 I402N probably damaging Het
Synj1 C T 16: 90,987,402 V283I probably benign Het
Tas2r108 A G 6: 40,494,066 probably null Het
Ttpal A G 2: 163,615,403 N265S probably benign Het
Unc80 G A 1: 66,637,957 G2015D probably damaging Het
Upf1 C T 8: 70,343,367 W138* probably null Het
Vmn1r25 T G 6: 57,978,801 M168L probably benign Het
Vmn2r18 A T 5: 151,586,836 F24Y probably benign Het
Vmn2r4 G T 3: 64,389,444 T640N probably damaging Het
Wdr75 T A 1: 45,803,870 probably null Het
Zfp648 A G 1: 154,204,392 Q99R probably benign Het
Zfp964 C T 8: 69,663,004 P85S probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63304171 missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63306101 missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63306413 missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63304066 missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63305983 missense probably benign
R8306:Zdbf2 UTSW 1 63304075 missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63304976 missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63306007 missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63309570 small deletion probably benign
R8528:Zdbf2 UTSW 1 63303386 missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63308113 missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63308003 missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63307137 missense
R9072:Zdbf2 UTSW 1 63305764 missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63308009 missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63306241 missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63304129 missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63305625 missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63303377 missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63303476 missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCAAAGCGTCGTGAGGCATC -3'
(R):5'- ACGAAGGGGCACTACTACTTCCAC -3'

Sequencing Primer
(F):5'- CGTGAGGCATCTCGTTCAAATAC -3'
(R):5'- GACGGTAGTGAGTCATCACCATC -3'
Posted On 2014-04-13