Incidental Mutation 'R1562:Zdbf2'
ID 170646
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 039601-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R1562 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63342747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 375 (S375R)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: S375R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S375R

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083151
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: S375R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S375R

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,336,331 (GRCm39) I2201V probably benign Het
Adam22 T C 5: 8,145,007 (GRCm39) N817S probably damaging Het
Alox12 C A 11: 70,140,991 (GRCm39) R348L probably damaging Het
Asb17 A T 3: 153,559,143 (GRCm39) T285S probably benign Het
Casp4 T C 9: 5,324,733 (GRCm39) S182P possibly damaging Het
Cenpe T C 3: 134,944,155 (GRCm39) M985T possibly damaging Het
Clcn1 C T 6: 42,277,169 (GRCm39) P420L probably benign Het
Coro2a T C 4: 46,548,917 (GRCm39) I126V probably benign Het
Cubn T C 2: 13,432,778 (GRCm39) Y1181C probably damaging Het
Cyp2d22 A T 15: 82,258,179 (GRCm39) L147Q probably damaging Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
Fat2 T C 11: 55,200,800 (GRCm39) N758S probably damaging Het
Fbxo43 T C 15: 36,163,162 (GRCm39) D15G probably damaging Het
Flt3 T C 5: 147,281,323 (GRCm39) E803G probably damaging Het
Folr1 T G 7: 101,507,801 (GRCm39) D213A probably damaging Het
Fus T C 7: 127,579,094 (GRCm39) V359A probably damaging Het
Gabrb3 C T 7: 57,415,262 (GRCm39) R111* probably null Het
Gm17324 T C 9: 78,355,964 (GRCm39) probably benign Het
Hormad2 A T 11: 4,358,848 (GRCm39) probably null Het
Ifi27l2b T A 12: 103,422,780 (GRCm39) probably null Het
Isg20 G T 7: 78,569,891 (GRCm39) C176F probably benign Het
Katnip C A 7: 125,442,020 (GRCm39) S643Y probably damaging Het
Krt15 C A 11: 100,024,007 (GRCm39) V346L probably benign Het
Liat1 A T 11: 75,894,024 (GRCm39) I134F probably damaging Het
Med13l A G 5: 118,876,584 (GRCm39) K920R probably damaging Het
Mlh3 A T 12: 85,313,694 (GRCm39) F831I probably benign Het
Mtmr9 A G 14: 63,771,786 (GRCm39) S267P probably benign Het
Mybpc1 C T 10: 88,389,193 (GRCm39) A406T probably damaging Het
Myh1 T C 11: 67,102,196 (GRCm39) M829T probably benign Het
Myo10 A G 15: 25,780,497 (GRCm39) Q209R possibly damaging Het
Nceh1 T A 3: 27,293,701 (GRCm39) V153D probably damaging Het
Oog3 A T 4: 143,889,169 (GRCm39) I3N probably damaging Het
Or1j19 A G 2: 36,676,696 (GRCm39) D53G probably damaging Het
Or2ag1b C T 7: 106,288,187 (GRCm39) M250I probably benign Het
Or4c103 T A 2: 88,513,423 (GRCm39) I218F probably benign Het
Or8c20 C A 9: 38,260,658 (GRCm39) S87* probably null Het
Pcnt G A 10: 76,203,164 (GRCm39) T2646M probably benign Het
Phf10 A T 17: 15,166,512 (GRCm39) C453S probably damaging Het
Plcb4 T A 2: 135,812,367 (GRCm39) probably null Het
Plekhh1 A G 12: 79,123,482 (GRCm39) H1185R probably benign Het
Prmt3 G T 7: 49,476,602 (GRCm39) V404L probably benign Het
Ptprb T A 10: 116,175,372 (GRCm39) D1122E probably benign Het
Rars1 A G 11: 35,711,921 (GRCm39) probably null Het
Rasa2 G T 9: 96,427,803 (GRCm39) N687K possibly damaging Het
Rbm11 A G 16: 75,393,423 (GRCm39) T40A probably damaging Het
Rem2 T C 14: 54,713,775 (GRCm39) V16A probably benign Het
Rlf A T 4: 121,007,588 (GRCm39) M574K possibly damaging Het
Rpap3 A T 15: 97,592,098 (GRCm39) V186D possibly damaging Het
Sertad3 G A 7: 27,176,048 (GRCm39) E161K probably damaging Het
Sh3gl2 T C 4: 85,304,130 (GRCm39) S278P probably benign Het
Strn3 T C 12: 51,680,401 (GRCm39) T400A probably benign Het
Sycp2 A T 2: 178,024,178 (GRCm39) I402N probably damaging Het
Synj1 C T 16: 90,784,290 (GRCm39) V283I probably benign Het
Tas2r108 A G 6: 40,471,000 (GRCm39) probably null Het
Ttpal A G 2: 163,457,323 (GRCm39) N265S probably benign Het
Unc80 G A 1: 66,677,116 (GRCm39) G2015D probably damaging Het
Upf1 C T 8: 70,796,017 (GRCm39) W138* probably null Het
Vmn1r25 T G 6: 57,955,786 (GRCm39) M168L probably benign Het
Vmn2r18 A T 5: 151,510,301 (GRCm39) F24Y probably benign Het
Vmn2r4 G T 3: 64,296,865 (GRCm39) T640N probably damaging Het
Wdr75 T A 1: 45,843,030 (GRCm39) probably null Het
Zfp648 A G 1: 154,080,138 (GRCm39) Q99R probably benign Het
Zfp964 C T 8: 70,115,654 (GRCm39) P85S probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCAAAGCGTCGTGAGGCATC -3'
(R):5'- ACGAAGGGGCACTACTACTTCCAC -3'

Sequencing Primer
(F):5'- CGTGAGGCATCTCGTTCAAATAC -3'
(R):5'- GACGGTAGTGAGTCATCACCATC -3'
Posted On 2014-04-13