Incidental Mutation 'R1562:Vmn2r4'
ID170658
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission 039601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1562 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64389444 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 640 (T640N)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]
Predicted Effect probably damaging
Transcript: ENSMUST00000170280
AA Change: T551N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049
AA Change: T551N

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 2.7e-72 PFAM
Pfam:Peripla_BP_6 61 240 1.9e-9 PFAM
Pfam:NCD3G 458 511 1.1e-17 PFAM
Pfam:7tm_3 542 779 1.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175724
AA Change: T640N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: T640N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,198 I134F probably damaging Het
Abca2 A G 2: 25,446,319 I2201V probably benign Het
Adam22 T C 5: 8,095,007 N817S probably damaging Het
Alox12 C A 11: 70,250,165 R348L probably damaging Het
Asb17 A T 3: 153,853,506 T285S probably benign Het
Casp4 T C 9: 5,324,733 S182P possibly damaging Het
Cenpe T C 3: 135,238,394 M985T possibly damaging Het
Clcn1 C T 6: 42,300,235 P420L probably benign Het
Coro2a T C 4: 46,548,917 I126V probably benign Het
Cubn T C 2: 13,427,967 Y1181C probably damaging Het
Cyp2d22 A T 15: 82,373,978 L147Q probably damaging Het
D430042O09Rik C A 7: 125,842,848 S643Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fat2 T C 11: 55,309,974 N758S probably damaging Het
Fbxo43 T C 15: 36,163,016 D15G probably damaging Het
Flt3 T C 5: 147,344,513 E803G probably damaging Het
Folr1 T G 7: 101,858,594 D213A probably damaging Het
Fus T C 7: 127,979,922 V359A probably damaging Het
Gabrb3 C T 7: 57,765,514 R111* probably null Het
Gm17324 T C 9: 78,448,682 probably benign Het
Hormad2 A T 11: 4,408,848 probably null Het
Ifi27l2b T A 12: 103,456,521 probably null Het
Isg20 G T 7: 78,920,143 C176F probably benign Het
Krt15 C A 11: 100,133,181 V346L probably benign Het
Med13l A G 5: 118,738,519 K920R probably damaging Het
Mlh3 A T 12: 85,266,920 F831I probably benign Het
Mtmr9 A G 14: 63,534,337 S267P probably benign Het
Mybpc1 C T 10: 88,553,331 A406T probably damaging Het
Myh1 T C 11: 67,211,370 M829T probably benign Het
Myo10 A G 15: 25,780,411 Q209R possibly damaging Het
Nceh1 T A 3: 27,239,552 V153D probably damaging Het
Olfr1195 T A 2: 88,683,079 I218F probably benign Het
Olfr348 A G 2: 36,786,684 D53G probably damaging Het
Olfr694 C T 7: 106,688,980 M250I probably benign Het
Olfr898 C A 9: 38,349,362 S87* probably null Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pcnt G A 10: 76,367,330 T2646M probably benign Het
Phf10 A T 17: 14,946,250 C453S probably damaging Het
Plcb4 T A 2: 135,970,447 probably null Het
Plekhh1 A G 12: 79,076,708 H1185R probably benign Het
Prmt3 G T 7: 49,826,854 V404L probably benign Het
Ptprb T A 10: 116,339,467 D1122E probably benign Het
Rars A G 11: 35,821,094 probably null Het
Rasa2 G T 9: 96,545,750 N687K possibly damaging Het
Rbm11 A G 16: 75,596,535 T40A probably damaging Het
Rem2 T C 14: 54,476,318 V16A probably benign Het
Rlf A T 4: 121,150,391 M574K possibly damaging Het
Rpap3 A T 15: 97,694,217 V186D possibly damaging Het
Sertad3 G A 7: 27,476,623 E161K probably damaging Het
Sh3gl2 T C 4: 85,385,893 S278P probably benign Het
Strn3 T C 12: 51,633,618 T400A probably benign Het
Sycp2 A T 2: 178,382,385 I402N probably damaging Het
Synj1 C T 16: 90,987,402 V283I probably benign Het
Tas2r108 A G 6: 40,494,066 probably null Het
Ttpal A G 2: 163,615,403 N265S probably benign Het
Unc80 G A 1: 66,637,957 G2015D probably damaging Het
Upf1 C T 8: 70,343,367 W138* probably null Het
Vmn1r25 T G 6: 57,978,801 M168L probably benign Het
Vmn2r18 A T 5: 151,586,836 F24Y probably benign Het
Wdr75 T A 1: 45,803,870 probably null Het
Zdbf2 T G 1: 63,303,588 S375R possibly damaging Het
Zfp648 A G 1: 154,204,392 Q99R probably benign Het
Zfp964 C T 8: 69,663,004 P85S probably benign Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64389474 missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64415169 missense probably damaging 1.00
R4710:Vmn2r4 UTSW 3 64409780 critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5907:Vmn2r4 UTSW 3 64391066 missense probably damaging 0.99
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64415278 missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64389310 missense probably damaging 1.00
R7049:Vmn2r4 UTSW 3 64389129 missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64415236 missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
R7941:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7971:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAAGCCCAGTGCCAGAGTGAC -3'
(R):5'- GGTATTAACCTGATGTGTGCCAGTCC -3'

Sequencing Primer
(F):5'- AGTGCCAGAGTGACCTGAC -3'
(R):5'- CAACTGAATCTGTCACATCATCTG -3'
Posted On2014-04-13