Mutagenetix > Incidental Mutation

Incidental Mutation 'R1562:Cenpe'

170660

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

039601-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1562 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135238394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 985 (M985T)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062893
AA Change: M985T

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: M985T

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197369

SMART Domains

Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
coiled coil region	2	49	N/A	INTRINSIC
coiled coil region	85	172	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016K19Rik	A	T	11: 76,003,198	I134F	probably damaging	Het
Abca2	A	G	2: 25,446,319	I2201V	probably benign	Het
Adam22	T	C	5: 8,095,007	N817S	probably damaging	Het
Alox12	C	A	11: 70,250,165	R348L	probably damaging	Het
Asb17	A	T	3: 153,853,506	T285S	probably benign	Het
Casp4	T	C	9: 5,324,733	S182P	possibly damaging	Het
Clcn1	C	T	6: 42,300,235	P420L	probably benign	Het
Coro2a	T	C	4: 46,548,917	I126V	probably benign	Het
Cubn	T	C	2: 13,427,967	Y1181C	probably damaging	Het
Cyp2d22	A	T	15: 82,373,978	L147Q	probably damaging	Het
D430042O09Rik	C	A	7: 125,842,848	S643Y	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Ecm1	G	A	3: 95,735,963	R342C	probably damaging	Het
Fat2	T	C	11: 55,309,974	N758S	probably damaging	Het
Fbxo43	T	C	15: 36,163,016	D15G	probably damaging	Het
Flt3	T	C	5: 147,344,513	E803G	probably damaging	Het
Folr1	T	G	7: 101,858,594	D213A	probably damaging	Het
Fus	T	C	7: 127,979,922	V359A	probably damaging	Het
Gabrb3	C	T	7: 57,765,514	R111*	probably null	Het
Gm17324	T	C	9: 78,448,682		probably benign	Het
Hormad2	A	T	11: 4,408,848		probably null	Het
Ifi27l2b	T	A	12: 103,456,521		probably null	Het
Isg20	G	T	7: 78,920,143	C176F	probably benign	Het
Krt15	C	A	11: 100,133,181	V346L	probably benign	Het
Med13l	A	G	5: 118,738,519	K920R	probably damaging	Het
Mlh3	A	T	12: 85,266,920	F831I	probably benign	Het
Mtmr9	A	G	14: 63,534,337	S267P	probably benign	Het
Mybpc1	C	T	10: 88,553,331	A406T	probably damaging	Het
Myh1	T	C	11: 67,211,370	M829T	probably benign	Het
Myo10	A	G	15: 25,780,411	Q209R	possibly damaging	Het
Nceh1	T	A	3: 27,239,552	V153D	probably damaging	Het
Olfr1195	T	A	2: 88,683,079	I218F	probably benign	Het
Olfr348	A	G	2: 36,786,684	D53G	probably damaging	Het
Olfr694	C	T	7: 106,688,980	M250I	probably benign	Het
Olfr898	C	A	9: 38,349,362	S87*	probably null	Het
Oog3	A	T	4: 144,162,599	I3N	probably damaging	Het
Pcnt	G	A	10: 76,367,330	T2646M	probably benign	Het
Phf10	A	T	17: 14,946,250	C453S	probably damaging	Het
Plcb4	T	A	2: 135,970,447		probably null	Het
Plekhh1	A	G	12: 79,076,708	H1185R	probably benign	Het
Prmt3	G	T	7: 49,826,854	V404L	probably benign	Het
Ptprb	T	A	10: 116,339,467	D1122E	probably benign	Het
Rars	A	G	11: 35,821,094		probably null	Het
Rasa2	G	T	9: 96,545,750	N687K	possibly damaging	Het
Rbm11	A	G	16: 75,596,535	T40A	probably damaging	Het
Rem2	T	C	14: 54,476,318	V16A	probably benign	Het
Rlf	A	T	4: 121,150,391	M574K	possibly damaging	Het
Rpap3	A	T	15: 97,694,217	V186D	possibly damaging	Het
Sertad3	G	A	7: 27,476,623	E161K	probably damaging	Het
Sh3gl2	T	C	4: 85,385,893	S278P	probably benign	Het
Strn3	T	C	12: 51,633,618	T400A	probably benign	Het
Sycp2	A	T	2: 178,382,385	I402N	probably damaging	Het
Synj1	C	T	16: 90,987,402	V283I	probably benign	Het
Tas2r108	A	G	6: 40,494,066		probably null	Het
Ttpal	A	G	2: 163,615,403	N265S	probably benign	Het
Unc80	G	A	1: 66,637,957	G2015D	probably damaging	Het
Upf1	C	T	8: 70,343,367	W138*	probably null	Het
Vmn1r25	T	G	6: 57,978,801	M168L	probably benign	Het
Vmn2r18	A	T	5: 151,586,836	F24Y	probably benign	Het
Vmn2r4	G	T	3: 64,389,444	T640N	probably damaging	Het
Wdr75	T	A	1: 45,803,870		probably null	Het
Zdbf2	T	G	1: 63,303,588	S375R	possibly damaging	Het
Zfp648	A	G	1: 154,204,392	Q99R	probably benign	Het
Zfp964	C	T	8: 69,663,004	P85S	probably benign	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GACCAACTCAGAAGTGACATTCAGGAC -3'
(R):5'- CCTTAAAAGACTGCTGTTACCTCAGGC -3'

Sequencing Primer
(F):5'- TGACATTCAGGACACTGTGAAC -3'
(R):5'- gaagaaacagatcagaggcaac -3'

Posted On

2014-04-13