Incidental Mutation 'R1562:Rlf'
ID170664
Institutional Source Beutler Lab
Gene Symbol Rlf
Ensembl Gene ENSMUSG00000049878
Gene Namerearranged L-myc fusion sequence
SynonymsMommeD8, 9230110M18Rik
MMRRC Submission 039601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1562 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location121145373-121215084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121150391 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 574 (M574K)
Ref Sequence ENSEMBL: ENSMUSP00000050825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056635] [ENSMUST00000168615]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056635
AA Change: M574K

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050825
Gene: ENSMUSG00000049878
AA Change: M574K

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
ZnF_C2H2 554 575 1.27e2 SMART
ZnF_C2H2 581 603 1.08e-1 SMART
ZnF_C2H2 667 692 5.42e-2 SMART
ZnF_C2H2 710 732 8.09e-1 SMART
ZnF_C2H2 738 762 3.99e0 SMART
ZnF_C2H2 767 791 3.16e-3 SMART
ZnF_C2H2 797 821 1.18e-2 SMART
low complexity region 885 909 N/A INTRINSIC
ZnF_C2H2 949 974 2.57e-3 SMART
low complexity region 1055 1066 N/A INTRINSIC
ZnF_C2H2 1122 1147 5.9e-3 SMART
ZnF_C2H2 1167 1190 4.17e-3 SMART
low complexity region 1259 1285 N/A INTRINSIC
ZnF_C2H2 1303 1328 5.06e-2 SMART
ZnF_C2H2 1355 1380 6.57e-1 SMART
ZnF_C2H2 1400 1425 3.83e-2 SMART
ZnF_C2H2 1437 1462 8.81e-2 SMART
low complexity region 1488 1514 N/A INTRINSIC
low complexity region 1521 1533 N/A INTRINSIC
ZnF_C2H2 1556 1581 4.81e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168615
AA Change: M464K

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127068
Gene: ENSMUSG00000049878
AA Change: M464K

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 444 465 1.27e2 SMART
ZnF_C2H2 471 493 1.08e-1 SMART
ZnF_C2H2 557 582 5.42e-2 SMART
ZnF_C2H2 600 622 8.09e-1 SMART
ZnF_C2H2 628 652 3.99e0 SMART
ZnF_C2H2 657 681 3.16e-3 SMART
ZnF_C2H2 687 711 1.18e-2 SMART
low complexity region 775 799 N/A INTRINSIC
ZnF_C2H2 839 864 2.57e-3 SMART
low complexity region 945 956 N/A INTRINSIC
ZnF_C2H2 1012 1037 5.9e-3 SMART
ZnF_C2H2 1057 1080 4.17e-3 SMART
low complexity region 1149 1175 N/A INTRINSIC
ZnF_C2H2 1193 1218 5.06e-2 SMART
ZnF_C2H2 1245 1270 6.57e-1 SMART
ZnF_C2H2 1290 1315 3.83e-2 SMART
ZnF_C2H2 1327 1352 8.81e-2 SMART
low complexity region 1378 1404 N/A INTRINSIC
low complexity region 1411 1423 N/A INTRINSIC
ZnF_C2H2 1446 1471 4.81e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic ENU-induced allele exhibit postnatal lethality. Only a few mice survive to weaning age exhibiting a decreased body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,198 I134F probably damaging Het
Abca2 A G 2: 25,446,319 I2201V probably benign Het
Adam22 T C 5: 8,095,007 N817S probably damaging Het
Alox12 C A 11: 70,250,165 R348L probably damaging Het
Asb17 A T 3: 153,853,506 T285S probably benign Het
Casp4 T C 9: 5,324,733 S182P possibly damaging Het
Cenpe T C 3: 135,238,394 M985T possibly damaging Het
Clcn1 C T 6: 42,300,235 P420L probably benign Het
Coro2a T C 4: 46,548,917 I126V probably benign Het
Cubn T C 2: 13,427,967 Y1181C probably damaging Het
Cyp2d22 A T 15: 82,373,978 L147Q probably damaging Het
D430042O09Rik C A 7: 125,842,848 S643Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fat2 T C 11: 55,309,974 N758S probably damaging Het
Fbxo43 T C 15: 36,163,016 D15G probably damaging Het
Flt3 T C 5: 147,344,513 E803G probably damaging Het
Folr1 T G 7: 101,858,594 D213A probably damaging Het
Fus T C 7: 127,979,922 V359A probably damaging Het
Gabrb3 C T 7: 57,765,514 R111* probably null Het
Gm17324 T C 9: 78,448,682 probably benign Het
Hormad2 A T 11: 4,408,848 probably null Het
Ifi27l2b T A 12: 103,456,521 probably null Het
Isg20 G T 7: 78,920,143 C176F probably benign Het
Krt15 C A 11: 100,133,181 V346L probably benign Het
Med13l A G 5: 118,738,519 K920R probably damaging Het
Mlh3 A T 12: 85,266,920 F831I probably benign Het
Mtmr9 A G 14: 63,534,337 S267P probably benign Het
Mybpc1 C T 10: 88,553,331 A406T probably damaging Het
Myh1 T C 11: 67,211,370 M829T probably benign Het
Myo10 A G 15: 25,780,411 Q209R possibly damaging Het
Nceh1 T A 3: 27,239,552 V153D probably damaging Het
Olfr1195 T A 2: 88,683,079 I218F probably benign Het
Olfr348 A G 2: 36,786,684 D53G probably damaging Het
Olfr694 C T 7: 106,688,980 M250I probably benign Het
Olfr898 C A 9: 38,349,362 S87* probably null Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pcnt G A 10: 76,367,330 T2646M probably benign Het
Phf10 A T 17: 14,946,250 C453S probably damaging Het
Plcb4 T A 2: 135,970,447 probably null Het
Plekhh1 A G 12: 79,076,708 H1185R probably benign Het
Prmt3 G T 7: 49,826,854 V404L probably benign Het
Ptprb T A 10: 116,339,467 D1122E probably benign Het
Rars A G 11: 35,821,094 probably null Het
Rasa2 G T 9: 96,545,750 N687K possibly damaging Het
Rbm11 A G 16: 75,596,535 T40A probably damaging Het
Rem2 T C 14: 54,476,318 V16A probably benign Het
Rpap3 A T 15: 97,694,217 V186D possibly damaging Het
Sertad3 G A 7: 27,476,623 E161K probably damaging Het
Sh3gl2 T C 4: 85,385,893 S278P probably benign Het
Strn3 T C 12: 51,633,618 T400A probably benign Het
Sycp2 A T 2: 178,382,385 I402N probably damaging Het
Synj1 C T 16: 90,987,402 V283I probably benign Het
Tas2r108 A G 6: 40,494,066 probably null Het
Ttpal A G 2: 163,615,403 N265S probably benign Het
Unc80 G A 1: 66,637,957 G2015D probably damaging Het
Upf1 C T 8: 70,343,367 W138* probably null Het
Vmn1r25 T G 6: 57,978,801 M168L probably benign Het
Vmn2r18 A T 5: 151,586,836 F24Y probably benign Het
Vmn2r4 G T 3: 64,389,444 T640N probably damaging Het
Wdr75 T A 1: 45,803,870 probably null Het
Zdbf2 T G 1: 63,303,588 S375R possibly damaging Het
Zfp648 A G 1: 154,204,392 Q99R probably benign Het
Zfp964 C T 8: 69,663,004 P85S probably benign Het
Other mutations in Rlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rlf APN 4 121170686 missense possibly damaging 0.89
IGL00558:Rlf APN 4 121150973 missense probably damaging 1.00
IGL00990:Rlf APN 4 121148339 missense possibly damaging 0.87
IGL01625:Rlf APN 4 121188260 missense possibly damaging 0.68
IGL01921:Rlf APN 4 121146746 missense probably damaging 1.00
IGL01986:Rlf APN 4 121148106 missense probably damaging 1.00
IGL02232:Rlf APN 4 121182614 missense probably benign 0.21
IGL02586:Rlf APN 4 121150064 missense probably damaging 1.00
IGL03177:Rlf APN 4 121148079 nonsense probably null
IGL03233:Rlf APN 4 121182600 splice site probably benign
IGL03293:Rlf APN 4 121148330 missense probably benign 0.18
Brady UTSW 4 121148553 nonsense probably null
bunch UTSW 4 121154975 missense probably damaging 1.00
transsubstantiation UTSW 4 121148291 missense probably benign 0.10
wafer UTSW 4 121150532 missense probably benign 0.00
Wine UTSW 4 121148172 missense probably damaging 1.00
PIT4651001:Rlf UTSW 4 121150313 missense probably damaging 0.98
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0039:Rlf UTSW 4 121146842 missense possibly damaging 0.90
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0590:Rlf UTSW 4 121170833 splice site probably benign
R1585:Rlf UTSW 4 121148291 missense probably benign 0.10
R1627:Rlf UTSW 4 121150000 missense probably benign 0.34
R1709:Rlf UTSW 4 121149823 missense probably benign 0.00
R1968:Rlf UTSW 4 121148420 missense probably damaging 1.00
R1982:Rlf UTSW 4 121150112 missense probably damaging 1.00
R3120:Rlf UTSW 4 121149483 missense probably benign 0.01
R3155:Rlf UTSW 4 121149332 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3429:Rlf UTSW 4 121150532 missense probably benign 0.00
R3430:Rlf UTSW 4 121150532 missense probably benign 0.00
R3700:Rlf UTSW 4 121150863 missense possibly damaging 0.77
R3732:Rlf UTSW 4 121148324 missense probably benign
R3909:Rlf UTSW 4 121149032 missense probably benign 0.00
R4033:Rlf UTSW 4 121147343 missense probably damaging 1.00
R4350:Rlf UTSW 4 121149096 missense probably benign 0.16
R4654:Rlf UTSW 4 121150601 missense probably benign 0.28
R4976:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5060:Rlf UTSW 4 121146866 missense probably benign 0.00
R5105:Rlf UTSW 4 121150367 missense probably damaging 1.00
R5119:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5150:Rlf UTSW 4 121148172 missense probably damaging 1.00
R5198:Rlf UTSW 4 121148553 nonsense probably null
R5214:Rlf UTSW 4 121150700 missense probably damaging 1.00
R6084:Rlf UTSW 4 121149215 missense possibly damaging 0.95
R6131:Rlf UTSW 4 121154975 missense probably damaging 1.00
R6188:Rlf UTSW 4 121170766 missense probably damaging 1.00
R6313:Rlf UTSW 4 121148610 missense probably damaging 0.99
R6332:Rlf UTSW 4 121148822 missense possibly damaging 0.75
R6341:Rlf UTSW 4 121149360 nonsense probably null
R6413:Rlf UTSW 4 121147325 missense probably damaging 1.00
R6683:Rlf UTSW 4 121147926 missense probably damaging 1.00
R7066:Rlf UTSW 4 121148787 missense probably benign
R7413:Rlf UTSW 4 121150100 missense probably damaging 1.00
R7640:Rlf UTSW 4 121146801 missense possibly damaging 0.96
R7641:Rlf UTSW 4 121159196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGGGTACAAGTCTCTGTCTTGC -3'
(R):5'- GAAGCCTCAGATTCCGATGATGACC -3'

Sequencing Primer
(F):5'- GCGGTCTTCTAACTTGCTAAATG -3'
(R):5'- ATTCCGATGATGACCTAAGTGGC -3'
Posted On2014-04-13