Incidental Mutation 'R1562:Folr1'
ID170677
Institutional Source Beutler Lab
Gene Symbol Folr1
Ensembl Gene ENSMUSG00000001827
Gene Namefolate receptor 1 (adult)
SynonymsFolbp-1, folate receptor [a], Folbp1, folate-binding protein 1, FBP1
MMRRC Submission 039601-MU
Accession Numbers

Ncbi RefSeq: NM_001252552.1, NM_008034.3, NM_001252553.1, NM_001252554.1; MGI:95568

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1562 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101858331-101870788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101858594 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 213 (D213A)
Ref Sequence ENSEMBL: ENSMUSP00000102599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106981] [ENSMUST00000106982] [ENSMUST00000106983] [ENSMUST00000106985] [ENSMUST00000106986] [ENSMUST00000126204] [ENSMUST00000134145] [ENSMUST00000140068] [ENSMUST00000151706] [ENSMUST00000210598]
Predicted Effect probably damaging
Transcript: ENSMUST00000106981
AA Change: D213A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102594
Gene: ENSMUSG00000001827
AA Change: D213A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106982
AA Change: D213A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102595
Gene: ENSMUSG00000001827
AA Change: D213A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106983
AA Change: D213A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102596
Gene: ENSMUSG00000001827
AA Change: D213A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 4.2e-68 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106985
AA Change: D213A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102598
Gene: ENSMUSG00000001827
AA Change: D213A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106986
AA Change: D213A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102599
Gene: ENSMUSG00000001827
AA Change: D213A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126204
SMART Domains Protein: ENSMUSP00000117175
Gene: ENSMUSG00000001827

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 137 2.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134145
SMART Domains Protein: ENSMUSP00000118547
Gene: ENSMUSG00000001827

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 104 2.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140068
SMART Domains Protein: ENSMUSP00000114633
Gene: ENSMUSG00000001827

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 160 9.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151706
SMART Domains Protein: ENSMUSP00000115077
Gene: ENSMUSG00000001827

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 157 8.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210598
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype Strain: 2383986
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Embryos homozygous for a knock-out allele are growth retarded and malformed, show multiple developmental anomalies, including neural and craniofacial defects, and die by E10. Folate supplementation of pregnant dams reduces embryonic mortality and improves many of the adverse developmental effects. [provided by MGI curators]
Allele List at MGI

All alleles(359) : Targeted(3) Gene trapped(356)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,198 I134F probably damaging Het
Abca2 A G 2: 25,446,319 I2201V probably benign Het
Adam22 T C 5: 8,095,007 N817S probably damaging Het
Alox12 C A 11: 70,250,165 R348L probably damaging Het
Asb17 A T 3: 153,853,506 T285S probably benign Het
Casp4 T C 9: 5,324,733 S182P possibly damaging Het
Cenpe T C 3: 135,238,394 M985T possibly damaging Het
Clcn1 C T 6: 42,300,235 P420L probably benign Het
Coro2a T C 4: 46,548,917 I126V probably benign Het
Cubn T C 2: 13,427,967 Y1181C probably damaging Het
Cyp2d22 A T 15: 82,373,978 L147Q probably damaging Het
D430042O09Rik C A 7: 125,842,848 S643Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fat2 T C 11: 55,309,974 N758S probably damaging Het
Fbxo43 T C 15: 36,163,016 D15G probably damaging Het
Flt3 T C 5: 147,344,513 E803G probably damaging Het
Fus T C 7: 127,979,922 V359A probably damaging Het
Gabrb3 C T 7: 57,765,514 R111* probably null Het
Gm17324 T C 9: 78,448,682 probably benign Het
Hormad2 A T 11: 4,408,848 probably null Het
Ifi27l2b T A 12: 103,456,521 probably null Het
Isg20 G T 7: 78,920,143 C176F probably benign Het
Krt15 C A 11: 100,133,181 V346L probably benign Het
Med13l A G 5: 118,738,519 K920R probably damaging Het
Mlh3 A T 12: 85,266,920 F831I probably benign Het
Mtmr9 A G 14: 63,534,337 S267P probably benign Het
Mybpc1 C T 10: 88,553,331 A406T probably damaging Het
Myh1 T C 11: 67,211,370 M829T probably benign Het
Myo10 A G 15: 25,780,411 Q209R possibly damaging Het
Nceh1 T A 3: 27,239,552 V153D probably damaging Het
Olfr1195 T A 2: 88,683,079 I218F probably benign Het
Olfr348 A G 2: 36,786,684 D53G probably damaging Het
Olfr694 C T 7: 106,688,980 M250I probably benign Het
Olfr898 C A 9: 38,349,362 S87* probably null Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pcnt G A 10: 76,367,330 T2646M probably benign Het
Phf10 A T 17: 14,946,250 C453S probably damaging Het
Plcb4 T A 2: 135,970,447 probably null Het
Plekhh1 A G 12: 79,076,708 H1185R probably benign Het
Prmt3 G T 7: 49,826,854 V404L probably benign Het
Ptprb T A 10: 116,339,467 D1122E probably benign Het
Rars A G 11: 35,821,094 probably null Het
Rasa2 G T 9: 96,545,750 N687K possibly damaging Het
Rbm11 A G 16: 75,596,535 T40A probably damaging Het
Rem2 T C 14: 54,476,318 V16A probably benign Het
Rlf A T 4: 121,150,391 M574K possibly damaging Het
Rpap3 A T 15: 97,694,217 V186D possibly damaging Het
Sertad3 G A 7: 27,476,623 E161K probably damaging Het
Sh3gl2 T C 4: 85,385,893 S278P probably benign Het
Strn3 T C 12: 51,633,618 T400A probably benign Het
Sycp2 A T 2: 178,382,385 I402N probably damaging Het
Synj1 C T 16: 90,987,402 V283I probably benign Het
Tas2r108 A G 6: 40,494,066 probably null Het
Ttpal A G 2: 163,615,403 N265S probably benign Het
Unc80 G A 1: 66,637,957 G2015D probably damaging Het
Upf1 C T 8: 70,343,367 W138* probably null Het
Vmn1r25 T G 6: 57,978,801 M168L probably benign Het
Vmn2r18 A T 5: 151,586,836 F24Y probably benign Het
Vmn2r4 G T 3: 64,389,444 T640N probably damaging Het
Wdr75 T A 1: 45,803,870 probably null Het
Zdbf2 T G 1: 63,303,588 S375R possibly damaging Het
Zfp648 A G 1: 154,204,392 Q99R probably benign Het
Zfp964 C T 8: 69,663,004 P85S probably benign Het
Other mutations in Folr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Folr1 APN 7 101858740 missense probably benign 0.00
IGL02423:Folr1 APN 7 101858525 missense probably benign 0.00
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R1022:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1024:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R2299:Folr1 UTSW 7 101863992 missense probably damaging 1.00
R3690:Folr1 UTSW 7 101858538 missense probably benign 0.06
R4746:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R4747:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R5319:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R6243:Folr1 UTSW 7 101863965 missense probably damaging 1.00
R6275:Folr1 UTSW 7 101859535 missense probably damaging 0.99
R7284:Folr1 UTSW 7 101859470 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTAAAGAGGCTGTCAGAGCCCCAC -3'
(R):5'- GCACAGGGACTAACGATCTTCCATC -3'

Sequencing Primer
(F):5'- CCACCACAAAGGAGGCTGG -3'
(R):5'- GCTGCTCTGTGTGAGGAAATCT -3'
Posted On2014-04-13