Incidental Mutation 'R1562:Dna2'
ID170688
Institutional Source Beutler Lab
Gene Symbol Dna2
Ensembl Gene ENSMUSG00000036875
Gene NameDNA replication helicase/nuclease 2
SynonymsE130315B21Rik, Dna2l
MMRRC Submission 039601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1562 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62947026-62974185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62949187 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 28 (R28W)
Ref Sequence ENSEMBL: ENSMUSP00000115750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044977] [ENSMUST00000092462] [ENSMUST00000131422] [ENSMUST00000144459]
Predicted Effect probably benign
Transcript: ENSMUST00000044977
SMART Domains Protein: ENSMUSP00000043370
Gene: ENSMUSG00000071253

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:Mito_carr 32 125 1.7e-25 PFAM
Pfam:Mito_carr 127 220 2.3e-26 PFAM
Pfam:Mito_carr 237 332 8.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092462
AA Change: R28W

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090119
Gene: ENSMUSG00000036875
AA Change: R28W

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 68 284 4.7e-75 PFAM
Pfam:PDDEXK_1 125 404 4.3e-13 PFAM
Pfam:AAA_11 626 799 6.7e-42 PFAM
Pfam:AAA_30 626 848 1.1e-15 PFAM
Pfam:AAA_19 633 709 5.7e-9 PFAM
Pfam:AAA_12 806 944 4.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129785
Predicted Effect probably benign
Transcript: ENSMUST00000131422
AA Change: R28W

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115750
Gene: ENSMUSG00000036875
AA Change: R28W

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 72 283 8.2e-65 PFAM
Pfam:PDDEXK_1 125 404 3e-11 PFAM
Pfam:AAA_11 626 732 7.8e-17 PFAM
Pfam:AAA_30 626 848 1.3e-15 PFAM
Pfam:AAA_19 633 709 6.2e-9 PFAM
Pfam:AAA_11 722 799 1.2e-21 PFAM
Pfam:AAA_12 806 1020 5.3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131715
Predicted Effect probably benign
Transcript: ENSMUST00000144459
SMART Domains Protein: ENSMUSP00000114510
Gene: ENSMUSG00000071253

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:Mito_carr 32 125 9.4e-28 PFAM
Pfam:Mito_carr 126 223 4.6e-25 PFAM
Pfam:Mito_carr 240 322 2.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152350
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA2/NAM7 helicase family. The encoded protein is a conserved helicase/nuclease involved in the maintenance of mitochondrial and nuclear DNA stability. Mutations in this gene are associated with autosomal dominant progressive external ophthalmoplegia-6 (PEOA6) and Seckel syndrome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E7.5. Mice heterozygous for the allele exhibit shortened telomeres, chromosome segregation errors and increased tumor incidence associated with aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,198 I134F probably damaging Het
Abca2 A G 2: 25,446,319 I2201V probably benign Het
Adam22 T C 5: 8,095,007 N817S probably damaging Het
Alox12 C A 11: 70,250,165 R348L probably damaging Het
Asb17 A T 3: 153,853,506 T285S probably benign Het
Casp4 T C 9: 5,324,733 S182P possibly damaging Het
Cenpe T C 3: 135,238,394 M985T possibly damaging Het
Clcn1 C T 6: 42,300,235 P420L probably benign Het
Coro2a T C 4: 46,548,917 I126V probably benign Het
Cubn T C 2: 13,427,967 Y1181C probably damaging Het
Cyp2d22 A T 15: 82,373,978 L147Q probably damaging Het
D430042O09Rik C A 7: 125,842,848 S643Y probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fat2 T C 11: 55,309,974 N758S probably damaging Het
Fbxo43 T C 15: 36,163,016 D15G probably damaging Het
Flt3 T C 5: 147,344,513 E803G probably damaging Het
Folr1 T G 7: 101,858,594 D213A probably damaging Het
Fus T C 7: 127,979,922 V359A probably damaging Het
Gabrb3 C T 7: 57,765,514 R111* probably null Het
Gm17324 T C 9: 78,448,682 probably benign Het
Hormad2 A T 11: 4,408,848 probably null Het
Ifi27l2b T A 12: 103,456,521 probably null Het
Isg20 G T 7: 78,920,143 C176F probably benign Het
Krt15 C A 11: 100,133,181 V346L probably benign Het
Med13l A G 5: 118,738,519 K920R probably damaging Het
Mlh3 A T 12: 85,266,920 F831I probably benign Het
Mtmr9 A G 14: 63,534,337 S267P probably benign Het
Mybpc1 C T 10: 88,553,331 A406T probably damaging Het
Myh1 T C 11: 67,211,370 M829T probably benign Het
Myo10 A G 15: 25,780,411 Q209R possibly damaging Het
Nceh1 T A 3: 27,239,552 V153D probably damaging Het
Olfr1195 T A 2: 88,683,079 I218F probably benign Het
Olfr348 A G 2: 36,786,684 D53G probably damaging Het
Olfr694 C T 7: 106,688,980 M250I probably benign Het
Olfr898 C A 9: 38,349,362 S87* probably null Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pcnt G A 10: 76,367,330 T2646M probably benign Het
Phf10 A T 17: 14,946,250 C453S probably damaging Het
Plcb4 T A 2: 135,970,447 probably null Het
Plekhh1 A G 12: 79,076,708 H1185R probably benign Het
Prmt3 G T 7: 49,826,854 V404L probably benign Het
Ptprb T A 10: 116,339,467 D1122E probably benign Het
Rars A G 11: 35,821,094 probably null Het
Rasa2 G T 9: 96,545,750 N687K possibly damaging Het
Rbm11 A G 16: 75,596,535 T40A probably damaging Het
Rem2 T C 14: 54,476,318 V16A probably benign Het
Rlf A T 4: 121,150,391 M574K possibly damaging Het
Rpap3 A T 15: 97,694,217 V186D possibly damaging Het
Sertad3 G A 7: 27,476,623 E161K probably damaging Het
Sh3gl2 T C 4: 85,385,893 S278P probably benign Het
Strn3 T C 12: 51,633,618 T400A probably benign Het
Sycp2 A T 2: 178,382,385 I402N probably damaging Het
Synj1 C T 16: 90,987,402 V283I probably benign Het
Tas2r108 A G 6: 40,494,066 probably null Het
Ttpal A G 2: 163,615,403 N265S probably benign Het
Unc80 G A 1: 66,637,957 G2015D probably damaging Het
Upf1 C T 8: 70,343,367 W138* probably null Het
Vmn1r25 T G 6: 57,978,801 M168L probably benign Het
Vmn2r18 A T 5: 151,586,836 F24Y probably benign Het
Vmn2r4 G T 3: 64,389,444 T640N probably damaging Het
Wdr75 T A 1: 45,803,870 probably null Het
Zdbf2 T G 1: 63,303,588 S375R possibly damaging Het
Zfp648 A G 1: 154,204,392 Q99R probably benign Het
Zfp964 C T 8: 69,663,004 P85S probably benign Het
Other mutations in Dna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dna2 APN 10 62966443 missense probably damaging 1.00
IGL00972:Dna2 APN 10 62950823 missense probably benign 0.13
IGL01511:Dna2 APN 10 62955314 missense possibly damaging 0.69
IGL01600:Dna2 APN 10 62950806 missense probably damaging 0.96
IGL02016:Dna2 APN 10 62960412 missense probably benign 0.00
IGL02049:Dna2 APN 10 62957036 missense probably damaging 0.99
IGL02069:Dna2 APN 10 62958994 missense probably benign 0.00
IGL02438:Dna2 APN 10 62957062 missense possibly damaging 0.92
IGL02743:Dna2 APN 10 62957042 missense possibly damaging 0.90
IGL02800:Dna2 APN 10 62961725 critical splice donor site probably null
IGL02936:Dna2 APN 10 62957100 missense probably damaging 1.00
supercoiled UTSW 10 62971993 splice site probably null
R0308:Dna2 UTSW 10 62956974 missense probably damaging 0.98
R0528:Dna2 UTSW 10 62958131 missense probably benign 0.00
R0669:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R0697:Dna2 UTSW 10 62949341 missense probably benign 0.01
R0831:Dna2 UTSW 10 62959329 nonsense probably null
R0839:Dna2 UTSW 10 62969782 missense probably damaging 1.00
R0991:Dna2 UTSW 10 62949187 missense probably benign 0.08
R0992:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1054:Dna2 UTSW 10 62963823 missense possibly damaging 0.84
R1082:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1084:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1184:Dna2 UTSW 10 62959198 missense probably benign 0.00
R1193:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1196:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1226:Dna2 UTSW 10 62960424 missense possibly damaging 0.88
R1561:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1566:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1568:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1598:Dna2 UTSW 10 62961657 missense probably damaging 0.99
R1768:Dna2 UTSW 10 62957084 missense probably benign 0.01
R2075:Dna2 UTSW 10 62969822 missense probably benign 0.20
R3125:Dna2 UTSW 10 62949202 missense possibly damaging 0.66
R3763:Dna2 UTSW 10 62966797 missense probably damaging 1.00
R4059:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R5002:Dna2 UTSW 10 62950842 missense probably damaging 1.00
R5160:Dna2 UTSW 10 62947154 missense probably benign
R5567:Dna2 UTSW 10 62966673 missense possibly damaging 0.89
R5775:Dna2 UTSW 10 62949242 missense possibly damaging 0.94
R5984:Dna2 UTSW 10 62962506 critical splice donor site probably null
R6604:Dna2 UTSW 10 62967743 critical splice donor site probably null
R6702:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6703:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6812:Dna2 UTSW 10 62959341 missense probably benign 0.18
R6820:Dna2 UTSW 10 62964904 missense possibly damaging 0.93
R6919:Dna2 UTSW 10 62957003 missense probably damaging 1.00
R7029:Dna2 UTSW 10 62963994 missense probably damaging 1.00
R7082:Dna2 UTSW 10 62954317 missense possibly damaging 0.71
R7508:Dna2 UTSW 10 62971993 splice site probably null
R7513:Dna2 UTSW 10 62971968 missense probably benign 0.00
R7605:Dna2 UTSW 10 62960275 missense probably benign 0.02
R7742:Dna2 UTSW 10 62973294 missense probably benign 0.31
R7868:Dna2 UTSW 10 62969864 missense probably benign 0.00
R7983:Dna2 UTSW 10 62955394 missense probably benign 0.04
R8508:Dna2 UTSW 10 62950894 missense probably damaging 1.00
RF007:Dna2 UTSW 10 62966695 missense probably damaging 0.99
Z1177:Dna2 UTSW 10 62962424 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGGTTCATCGTGTCCAGCTTC -3'
(R):5'- TGCACAGAACTTCGTGCTCTCG -3'

Sequencing Primer
(F):5'- ccaccacactcagacacc -3'
(R):5'- TCGTGCTCTCGGTCCTG -3'
Posted On2014-04-13