Incidental Mutation 'R1563:Sned1'
ID170718
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission 039602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1563 (G1)
Quality Score165
Status Validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93281654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 830 (V830M)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062202
AA Change: V830M

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: V830M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163688
AA Change: V39M
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793
AA Change: V39M

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,719,534 Y707C probably damaging Het
4930519G04Rik T C 5: 114,863,508 M22T probably benign Het
A930018M24Rik A G 14: 50,897,119 L22P probably damaging Het
Aipl1 A T 11: 72,036,712 M59K probably damaging Het
Atg2b T C 12: 105,623,488 I1835V probably damaging Het
Cacna1i T C 15: 80,321,188 V115A probably damaging Het
Cacna1i A T 15: 80,389,855 probably benign Het
Catsperb T A 12: 101,588,102 M685K probably damaging Het
Cdh10 T A 15: 18,986,767 Y361* probably null Het
Clcn4 C T 7: 7,293,982 C219Y probably damaging Het
Cpeb2 G A 5: 43,285,737 V924M probably damaging Het
Cpxm2 T C 7: 132,143,682 E138G probably benign Het
Dennd1a T C 2: 37,858,429 Y346C probably damaging Het
Dnah8 T A 17: 30,635,664 L100Q probably benign Het
Dnajc6 A C 4: 101,599,137 N76T probably damaging Het
Ehbp1 A G 11: 22,059,231 L954P probably damaging Het
Eral1 A T 11: 78,075,406 D315E probably benign Het
Fam129a A T 1: 151,715,673 Y522F possibly damaging Het
Fbln2 G T 6: 91,263,383 E724* probably null Het
Fyco1 A G 9: 123,827,182 probably benign Het
Fzd3 T A 14: 65,235,724 E198D probably damaging Het
Fzd9 T C 5: 135,250,554 N159S probably damaging Het
Galnt6 T A 15: 100,703,378 Q340L probably benign Het
Gm20939 C T 17: 94,877,094 A390V probably damaging Het
Gm5435 T G 12: 82,495,690 noncoding transcript Het
Gm9949 A C 18: 62,184,018 probably benign Het
Gprc5b G A 7: 118,983,761 T295I probably benign Het
Gria2 G T 3: 80,691,397 Q777K probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haao T C 17: 83,834,889 T174A probably benign Het
Hes6 A T 1: 91,413,136 M1K probably null Het
Hook3 G T 8: 26,110,752 Q43K probably benign Het
Klhl35 T C 7: 99,471,695 V390A probably damaging Het
Myh9 G T 15: 77,771,857 T1151K probably damaging Het
Nbn A T 4: 15,981,668 I587F possibly damaging Het
Nek4 A G 14: 30,982,451 D696G probably damaging Het
Nlrp2 T C 7: 5,308,725 D52G probably damaging Het
Oit3 G T 10: 59,428,074 R413S probably damaging Het
Olfr1298 T A 2: 111,645,682 H105L probably damaging Het
Olfr786 A G 10: 129,437,711 M300V probably benign Het
Otof T C 5: 30,371,005 T1870A probably benign Het
Pdgfd T C 9: 6,293,939 probably null Het
Pitrm1 T C 13: 6,563,470 V526A possibly damaging Het
Pknox1 T C 17: 31,595,282 S194P probably damaging Het
Plekhg5 T C 4: 152,096,809 S8P probably benign Het
Ppp1r13b T C 12: 111,840,982 E157G probably damaging Het
Psmd3 C T 11: 98,694,225 R466W probably damaging Het
Ptgfrn A G 3: 101,060,651 F542S possibly damaging Het
Ptgs1 A T 2: 36,245,202 M393L possibly damaging Het
Qpct T A 17: 79,064,063 S87T probably benign Het
Qtrt1 T A 9: 21,419,311 V269D probably benign Het
Rassf9 C G 10: 102,544,960 R68G probably damaging Het
Rif1 A G 2: 52,073,223 E25G probably damaging Het
Rnf213 T C 11: 119,414,526 F528L probably benign Het
Sgip1 T C 4: 102,966,260 S693P probably benign Het
She A G 3: 89,854,614 D460G probably benign Het
Sipa1l1 G T 12: 82,341,161 V54L probably benign Het
Slc8a3 T A 12: 81,205,007 D640V possibly damaging Het
Smurf1 T A 5: 144,882,513 E601D probably damaging Het
Synpo2l A G 14: 20,661,278 S425P probably damaging Het
Tbck T C 3: 132,715,693 V187A possibly damaging Het
Tcf23 A T 5: 30,968,831 H18L probably benign Het
Tcp11l2 A G 10: 84,584,944 S16G probably damaging Het
Tekt2 T A 4: 126,323,407 M233L probably benign Het
Tex14 T C 11: 87,536,808 S29P probably damaging Het
Tjp2 T A 19: 24,132,703 N59I probably damaging Het
Tlr5 G A 1: 182,975,010 M626I probably benign Het
Tnn A T 1: 160,125,415 V685D probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trhr G A 15: 44,197,101 V6I probably benign Het
Trim30c C T 7: 104,382,951 R301Q probably benign Het
Usp51 T C X: 153,007,992 I194T probably benign Het
Vmn2r63 A G 7: 42,904,126 S569P probably benign Het
Vps26a T G 10: 62,464,680 I236L probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zcchc14 T C 8: 121,603,979 M882V probably benign Het
Zfhx2 A G 14: 55,065,088 V1813A probably benign Het
Zswim2 C T 2: 83,915,282 G604D possibly damaging Het
Zzef1 C T 11: 72,848,733 Q669* probably null Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
R7679:Sned1 UTSW 1 93236038 missense unknown
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCTCTTGCTGGACAAGCTAC -3'
(R):5'- TCCTGAAAAGCCTGACCAAGTGTG -3'

Sequencing Primer
(F):5'- TTGCTGGACAAGCTACTCAGAG -3'
(R):5'- GCCTATCCAGGGACAACAGAG -3'
Posted On2014-04-13