Mutagenetix > Incidental Mutation

Incidental Mutation 'R1563:Nlrp2'

170749

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

039602-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1563 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5308725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 52 (D52G)

Ref Sequence

ENSEMBL: ENSMUSP00000146451 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]

AlphaFold

Q4PLS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000045022
AA Change: D917G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: D917G

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000207520
AA Change: D122G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000207685
AA Change: D52G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207938

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.4%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,719,534	Y707C	probably damaging	Het
4930519G04Rik	T	C	5: 114,863,508	M22T	probably benign	Het
A930018M24Rik	A	G	14: 50,897,119	L22P	probably damaging	Het
Aipl1	A	T	11: 72,036,712	M59K	probably damaging	Het
Atg2b	T	C	12: 105,623,488	I1835V	probably damaging	Het
Cacna1i	T	C	15: 80,321,188	V115A	probably damaging	Het
Cacna1i	A	T	15: 80,389,855		probably benign	Het
Catsperb	T	A	12: 101,588,102	M685K	probably damaging	Het
Cdh10	T	A	15: 18,986,767	Y361*	probably null	Het
Clcn4	C	T	7: 7,293,982	C219Y	probably damaging	Het
Cpeb2	G	A	5: 43,285,737	V924M	probably damaging	Het
Cpxm2	T	C	7: 132,143,682	E138G	probably benign	Het
Dennd1a	T	C	2: 37,858,429	Y346C	probably damaging	Het
Dnah8	T	A	17: 30,635,664	L100Q	probably benign	Het
Dnajc6	A	C	4: 101,599,137	N76T	probably damaging	Het
Ehbp1	A	G	11: 22,059,231	L954P	probably damaging	Het
Eral1	A	T	11: 78,075,406	D315E	probably benign	Het
Fam129a	A	T	1: 151,715,673	Y522F	possibly damaging	Het
Fbln2	G	T	6: 91,263,383	E724*	probably null	Het
Fyco1	A	G	9: 123,827,182		probably benign	Het
Fzd3	T	A	14: 65,235,724	E198D	probably damaging	Het
Fzd9	T	C	5: 135,250,554	N159S	probably damaging	Het
Galnt6	T	A	15: 100,703,378	Q340L	probably benign	Het
Gm20939	C	T	17: 94,877,094	A390V	probably damaging	Het
Gm5435	T	G	12: 82,495,690		noncoding transcript	Het
Gm9949	A	C	18: 62,184,018		probably benign	Het
Gprc5b	G	A	7: 118,983,761	T295I	probably benign	Het
Gria2	G	T	3: 80,691,397	Q777K	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Haao	T	C	17: 83,834,889	T174A	probably benign	Het
Hes6	A	T	1: 91,413,136	M1K	probably null	Het
Hook3	G	T	8: 26,110,752	Q43K	probably benign	Het
Klhl35	T	C	7: 99,471,695	V390A	probably damaging	Het
Myh9	G	T	15: 77,771,857	T1151K	probably damaging	Het
Nbn	A	T	4: 15,981,668	I587F	possibly damaging	Het
Nek4	A	G	14: 30,982,451	D696G	probably damaging	Het
Oit3	G	T	10: 59,428,074	R413S	probably damaging	Het
Olfr1298	T	A	2: 111,645,682	H105L	probably damaging	Het
Olfr786	A	G	10: 129,437,711	M300V	probably benign	Het
Otof	T	C	5: 30,371,005	T1870A	probably benign	Het
Pdgfd	T	C	9: 6,293,939		probably null	Het
Pitrm1	T	C	13: 6,563,470	V526A	possibly damaging	Het
Pknox1	T	C	17: 31,595,282	S194P	probably damaging	Het
Plekhg5	T	C	4: 152,096,809	S8P	probably benign	Het
Ppp1r13b	T	C	12: 111,840,982	E157G	probably damaging	Het
Psmd3	C	T	11: 98,694,225	R466W	probably damaging	Het
Ptgfrn	A	G	3: 101,060,651	F542S	possibly damaging	Het
Ptgs1	A	T	2: 36,245,202	M393L	possibly damaging	Het
Qpct	T	A	17: 79,064,063	S87T	probably benign	Het
Qtrt1	T	A	9: 21,419,311	V269D	probably benign	Het
Rassf9	C	G	10: 102,544,960	R68G	probably damaging	Het
Rif1	A	G	2: 52,073,223	E25G	probably damaging	Het
Rnf213	T	C	11: 119,414,526	F528L	probably benign	Het
Sgip1	T	C	4: 102,966,260	S693P	probably benign	Het
She	A	G	3: 89,854,614	D460G	probably benign	Het
Sipa1l1	G	T	12: 82,341,161	V54L	probably benign	Het
Slc8a3	T	A	12: 81,205,007	D640V	possibly damaging	Het
Smurf1	T	A	5: 144,882,513	E601D	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Synpo2l	A	G	14: 20,661,278	S425P	probably damaging	Het
Tbck	T	C	3: 132,715,693	V187A	possibly damaging	Het
Tcf23	A	T	5: 30,968,831	H18L	probably benign	Het
Tcp11l2	A	G	10: 84,584,944	S16G	probably damaging	Het
Tekt2	T	A	4: 126,323,407	M233L	probably benign	Het
Tex14	T	C	11: 87,536,808	S29P	probably damaging	Het
Tjp2	T	A	19: 24,132,703	N59I	probably damaging	Het
Tlr5	G	A	1: 182,975,010	M626I	probably benign	Het
Tnn	A	T	1: 160,125,415	V685D	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trhr	G	A	15: 44,197,101	V6I	probably benign	Het
Trim30c	C	T	7: 104,382,951	R301Q	probably benign	Het
Usp51	T	C	X: 153,007,992	I194T	probably benign	Het
Vmn2r63	A	G	7: 42,904,126	S569P	probably benign	Het
Vps26a	T	G	10: 62,464,680	I236L	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zcchc14	T	C	8: 121,603,979	M882V	probably benign	Het
Zfhx2	A	G	14: 55,065,088	V1813A	probably benign	Het
Zswim2	C	T	2: 83,915,282	G604D	possibly damaging	Het
Zzef1	C	T	11: 72,848,733	Q669*	probably null	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
R8785:Nlrp2	UTSW	7	5327549	missense	probably damaging	0.99
R8798:Nlrp2	UTSW	7	5327888	missense	possibly damaging	0.86
R8982:Nlrp2	UTSW	7	5324979	missense	probably damaging	1.00
R9030:Nlrp2	UTSW	7	5322458	missense	probably null	0.00
R9038:Nlrp2	UTSW	7	5327479	missense	probably benign	0.14
R9149:Nlrp2	UTSW	7	5327573	missense	probably benign	0.01
R9229:Nlrp2	UTSW	7	5301053	missense	possibly damaging	0.81
R9584:Nlrp2	UTSW	7	5319216	missense	probably damaging	1.00
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGACTCACTTGACTCAGGACTTCCC -3'
(R):5'- TGCCCTCATCTAGCCACATGTAGC -3'

Sequencing Primer
(F):5'- CCATATTGCTTCTGAAAGGGTC -3'
(R):5'- tcactcctttccaacttccc -3'

Posted On

2014-04-13